Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729493667:

Variant ID: vg0729493667 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29493667
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAACATGTCCAAATGCCCCATCTATTGTGTTATTGTGCATGTACTCCCTCCATACTCATAAAAGAAGTCGTTTAGGACAATGTTTAAGTCAAACATTG[A/G]
GAATATAAATCATGAATAACTCTCAAGTTGTCGAGTTTAAAAATGTAAAAGTTATATGTATAGATTTGTCTTGAAAAATACTTCCATACAAGTATACATA

Reverse complement sequence

TATGTATACTTGTATGGAAGTATTTTTCAAGACAAATCTATACATATAACTTTTACATTTTTAAACTCGACAACTTGAGAGTTATTCATGATTTATATTC[T/C]
CAATGTTTGACTTAAACATTGTCCTAAACGACTTCTTTTATGAGTATGGAGGGAGTACATGCACAATAACACAATAGATGGGGCATTTGGACATGTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	19.70%	0.25%	0.00%	NA
All Indica	2759	78.60%	21.10%	0.33%	0.00%	NA
All Japonica	1512	78.00%	22.00%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.50%	5.50%	0.00%	0.00%	NA
Indica II	465	89.70%	9.70%	0.65%	0.00%	NA
Indica III	913	64.00%	35.70%	0.33%	0.00%	NA
Indica Intermediate	786	77.00%	22.60%	0.38%	0.00%	NA
Temperate Japonica	767	93.90%	6.00%	0.13%	0.00%	NA
Tropical Japonica	504	49.40%	50.60%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729493667	A -> G	LOC_Os07g49260.1	upstream_gene_variant ; 2247.0bp to feature; MODIFIER	silent_mutation	Average:86.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.274	N	N	N	N
vg0729493667	A -> G	LOC_Os07g49250.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:86.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.274	N	N	N	N
vg0729493667	A -> G	LOC_Os07g49250-LOC_Os07g49260	intergenic_region ; MODIFIER	silent_mutation	Average:86.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.274	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0729493667	A	G	-0.01	-0.02	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729493667	NA	2.36E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	6.25E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	2.26E-06	2.26E-06	mr1159	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	7.58E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	4.81E-06	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	3.71E-07	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	2.36E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729493667	NA	1.42E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251