\
| Variant ID: vg0729492205 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29492205 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATTATTATATGGTTTATTTAAGGTGAAATCCACTGTGTTAAATTCGCTTGGATATATTTTTTGTTAGAAAATTATGAGCTGTAATTAGGAGTCCCACC[G/A]
TCTCAAGTTTGCGAGTTTTTTAAAGAGATTTCTTGTACGATTTCTTTTGTATTTTCAAAAGCGAACAAACTTAAAACATGACTCGTACACGGATAACGTA
TACGTTATCCGTGTACGAGTCATGTTTTAAGTTTGTTCGCTTTTGAAAATACAAAAGAAATCGTACAAGAAATCTCTTTAAAAAACTCGCAAACTTGAGA[C/T]
GGTGGGACTCCTAATTACAGCTCATAATTTTCTAACAAAAAATATATCCAAGCGAATTTAACACAGTGGATTTCACCTTAAATAAACCATATAATAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 46.30% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 75.10% | 24.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 16.30% | 83.30% | 0.46% | 0.00% | NA |
| Aus | 269 | 58.70% | 40.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 58.30% | 41.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 73.00% | 26.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 31.90% | 67.10% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.80% | 66.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 60.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729492205 | G -> A | LOC_Os07g49260.1 | upstream_gene_variant ; 3709.0bp to feature; MODIFIER | silent_mutation | Average:50.414; most accessible tissue: Callus, score: 78.477 | N | N | N | N |
| vg0729492205 | G -> A | LOC_Os07g49240.1 | downstream_gene_variant ; 4767.0bp to feature; MODIFIER | silent_mutation | Average:50.414; most accessible tissue: Callus, score: 78.477 | N | N | N | N |
| vg0729492205 | G -> A | LOC_Os07g49250.1 | downstream_gene_variant ; 32.0bp to feature; MODIFIER | silent_mutation | Average:50.414; most accessible tissue: Callus, score: 78.477 | N | N | N | N |
| vg0729492205 | G -> A | LOC_Os07g49250-LOC_Os07g49260 | intergenic_region ; MODIFIER | silent_mutation | Average:50.414; most accessible tissue: Callus, score: 78.477 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729492205 | NA | 9.63E-06 | mr1133 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | NA | 1.87E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | NA | 2.66E-11 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | 2.08E-06 | NA | mr1559 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | NA | 5.89E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | NA | 7.59E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729492205 | NA | 1.03E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |