\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729413494:

Variant ID: vg0729413494 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29413494
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTGCAAGAAACCAAACCCCGGATCGACAGCTCGTGAACAGATCAGGCGCCACAGCAAGCGGGGTGGAGAAGATGGTAGCGGCGGCTCACATCCCTTTC[G/A]
TCCGAGCAGCCAAATCAGCTAGCGAAGAGATCGGGGTCGCCGGATTCAGCGGCCCGGGCCTCCTCGCTAGCAAATGCAACGGCCTGACTGGGGAAAGAGG

Reverse complement sequence

CCTCTTTCCCCAGTCAGGCCGTTGCATTTGCTAGCGAGGAGGCCCGGGCCGCTGAATCCGGCGACCCCGATCTCTTCGCTAGCTGATTTGGCTGCTCGGA[C/T]
GAAAGGGATGTGAGCCGCCGCTACCATCTTCTCCACCCCGCTTGCTGTGGCGCCTGATCTGTTCACGAGCTGTCGATCCGGGGTTTGGTTTCTTGCAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 6.10% 0.34% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 95.30% 4.00% 0.73% 0.00% NA
Aus  269 71.00% 27.90% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 1.30% 0.91% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 15.40% 1.66% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729413494 G -> A LOC_Os07g49120.1 downstream_gene_variant ; 4394.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 flower, score: 97.403 N N N N
vg0729413494 G -> A LOC_Os07g49114-LOC_Os07g49120 intergenic_region ; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 flower, score: 97.403 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0729413494 G A 0.01 0.01 0.02 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729413494 7.11E-06 NA Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0729413494 1.75E-06 NA Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0729413494 NA 4.70E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729413494 NA 2.34E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729413494 NA 5.76E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729413494 6.68E-06 NA mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251