Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729363260:

Variant ID: vg0729363260 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 29363260
Reference Allele: AAlternative Allele: G,AT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTAGGGAGGACGGGGAGAAGTAGAGCGAAGAGAAATGAAGCACGTAAAGTATATAGGTTGAAATCATACACGTTGGTGGATACTTAATACGGATAAT[A/G,AT]
TTTTTTAGTATTCCAGTATTGTTAAAGAACCTAGAAATACCAAGAAACACTATAGTATGTATTTACTAGTACTTACCCTCCTTCGATAAAAAAACTCAAT

Reverse complement sequence

ATTGAGTTTTTTTATCGAAGGAGGGTAAGTACTAGTAAATACATACTATAGTGTTTCTTGGTATTTCTAGGTTCTTTAACAATACTGGAATACTAAAAAA[T/C,AT]
ATTATCCGTATTAAGTATCCACCAACGTGTATGATTTCAACCTATATACTTTACGTGCTTCATTTCTCTTCGCTCTACTTCTCCCCGTCCTCCCTACCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 35.90% 0.04% 0.00% AT: 0.97%
All Indica  2759 93.70% 4.80% 0.00% 0.00% AT: 1.45%
All Japonica  1512 11.30% 88.40% 0.00% 0.00% AT: 0.33%
Aus  269 65.80% 34.20% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 90.90% 4.70% 0.00% 0.00% AT: 4.38%
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 18.70% 80.40% 0.00% 0.00% AT: 0.99%
Japonica Intermediate  241 29.00% 71.00% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 42.20% 55.60% 1.11% 0.00% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729363260 A -> G LOC_Os07g49040.1 upstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:72.258; most accessible tissue: Callus, score: 88.805 N N N N
vg0729363260 A -> G LOC_Os07g49030-LOC_Os07g49040 intergenic_region ; MODIFIER silent_mutation Average:72.258; most accessible tissue: Callus, score: 88.805 N N N N
vg0729363260 A -> AT LOC_Os07g49040.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:72.258; most accessible tissue: Callus, score: 88.805 N N N N
vg0729363260 A -> AT LOC_Os07g49030-LOC_Os07g49040 intergenic_region ; MODIFIER silent_mutation Average:72.258; most accessible tissue: Callus, score: 88.805 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0729363260 A AT 0.06 0.12 0.06 0.0 0.01 0.02
vg0729363260 A G -0.05 -0.04 -0.03 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729363260 NA 6.29E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729363260 NA 1.33E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729363260 1.18E-06 NA mr1350_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729363260 NA 1.19E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729363260 NA 1.09E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251