\
| Variant ID: vg0729357717 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29357717 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
AGATGACGCCGTTAACTTTTTCTCACATGTTTAACCATTCGTTTTATTCAAAAATTTTATGCAATTGTATAAGATATAAATCACACTTAAAATACTATGA[G/T]
TAATAAAACAACTCATAACAAAATAAATTATAATTACCTAAATTTTTTAAATAAGACGAATGGTCAAACATGTGAGAAAAAGTTAACGGCGTTATCTATT
AATAGATAACGCCGTTAACTTTTTCTCACATGTTTGACCATTCGTCTTATTTAAAAAATTTAGGTAATTATAATTTATTTTGTTATGAGTTGTTTTATTA[C/A]
TCATAGTATTTTAAGTGTGATTTATATCTTATACAATTGCATAAAATTTTTGAATAAAACGAATGGTTAAACATGTGAGAAAAAGTTAACGGCGTCATCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 41.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 90.10% | 9.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 54.60% | 45.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.60% | 15.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 11.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729357717 | G -> T | LOC_Os07g49030.1 | upstream_gene_variant ; 402.0bp to feature; MODIFIER | silent_mutation | Average:89.253; most accessible tissue: Callus, score: 94.482 | N | N | N | N |
| vg0729357717 | G -> T | LOC_Os07g49030.2 | upstream_gene_variant ; 800.0bp to feature; MODIFIER | silent_mutation | Average:89.253; most accessible tissue: Callus, score: 94.482 | N | N | N | N |
| vg0729357717 | G -> T | LOC_Os07g49030-LOC_Os07g49040 | intergenic_region ; MODIFIER | silent_mutation | Average:89.253; most accessible tissue: Callus, score: 94.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729357717 | 9.80E-06 | 9.80E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | 5.24E-06 | 5.24E-06 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 7.84E-06 | mr1208 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 1.00E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 7.71E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 2.69E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 5.79E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 4.83E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 2.40E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 1.54E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 3.06E-07 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 9.25E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 5.42E-07 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 1.07E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 4.70E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 1.65E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 2.82E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | 4.11E-06 | 4.96E-37 | mr1888_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729357717 | NA | 3.28E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |