Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729311768:

Variant ID: vg0729311768 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29311768
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTCCAACTTTCCATCACATCACATCCAAAACTTTCGTACACACATAAACTCCCAACTTACTTTTTTTTTCCAAACTAACAACTTTCCCCAAACTTCTC[C/T]
CCAATTTCATGAACTAAATACAACCTATGAGAATGGCCAGACAACTCAGGTAATAGATGAAAGAAAAACAAACTATGAGCGTTGTATACAACTCCCTCCG

Reverse complement sequence

CGGAGGGAGTTGTATACAACGCTCATAGTTTGTTTTTCTTTCATCTATTACCTGAGTTGTCTGGCCATTCTCATAGGTTGTATTTAGTTCATGAAATTGG[G/A]
GAGAAGTTTGGGGAAAGTTGTTAGTTTGGAAAAAAAAAGTAAGTTGGGAGTTTATGTGTGTACGAAAGTTTTGGATGTGATGTGATGGAAAGTTGGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.80%	3.20%	0.02%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	80.70%	19.00%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729311768	C -> T	LOC_Os07g48970.1	downstream_gene_variant ; 4121.0bp to feature; MODIFIER	silent_mutation	Average:52.563; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0729311768	C -> T	LOC_Os07g48970.2	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:52.563; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0729311768	C -> T	LOC_Os07g48970-LOC_Os07g48980	intergenic_region ; MODIFIER	silent_mutation	Average:52.563; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729311768	NA	1.77E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	3.44E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	4.37E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	2.24E-06	2.24E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	6.54E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	7.58E-07	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	5.53E-07	5.53E-07	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	1.67E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	2.68E-06	mr1233	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	1.29E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	1.02E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	7.92E-06	7.92E-06	mr1436	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	2.32E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	1.12E-06	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	2.51E-07	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	1.09E-06	1.09E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	4.39E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	1.01E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729311768	NA	5.19E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251