Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729298014:

Variant ID: vg0729298014 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29298014
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 368. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGATAATGACATGCCTTGAAGATCTGTATTGTACCTTGATTTCTGCCACATCAGCTAAACCTCCAACAGAAAACCTGTAAAACTTCCTGTTCAGCGCA[C/T]
GTGCAATTGATCGACCAATACTAGTTTTACCAACTCCTGGTGGCCCAGAAAGACATATGATCTTTCCTGTCATAAATGATCCAACAAAGTTATTAGTTCA

Reverse complement sequence

TGAACTAATAACTTTGTTGGATCATTTATGACAGGAAAGATCATATGTCTTTCTGGGCCACCAGGAGTTGGTAAAACTAGTATTGGTCGATCAATTGCAC[G/A]
TGCGCTGAACAGGAAGTTTTACAGGTTTTCTGTTGGAGGTTTAGCTGATGTGGCAGAAATCAAGGTACAATACAGATCTTCAAGGCATGTCATTATCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.40%	10.00%	1.59%	0.00%	NA
All Indica	2759	80.90%	16.70%	2.46%	0.00%	NA
All Japonica	1512	99.80%	0.00%	0.20%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	94.60%	1.70%	3.70%	0.00%	NA
Indica II	465	42.20%	52.70%	5.16%	0.00%	NA
Indica III	913	94.70%	5.00%	0.22%	0.00%	NA
Indica Intermediate	786	77.20%	20.20%	2.54%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729298014	C -> T	LOC_Os07g48960.1	missense_variant ; p.Arg483His; MODERATE	nonsynonymous_codon ; R483H	Average:41.816; most accessible tissue: Callus, score: 73.656	benign	0.547	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729298014	NA	6.77E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	9.26E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	3.90E-06	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	1.67E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	7.79E-06	7.79E-06	mr1126_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	4.36E-07	4.37E-07	mr1279_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	1.54E-06	1.54E-06	mr1279_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	1.04E-08	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	3.13E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	2.18E-06	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	9.07E-06	9.05E-06	mr1473_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	2.36E-06	2.35E-06	mr1630_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	NA	5.98E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	4.03E-06	4.03E-06	mr1848_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729298014	3.07E-06	NA	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251