| Variant ID: vg0729253566 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29253566 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 117. )
ATTTGATTATAAAAACAAAACAATTTGATACAATTTTAAGACTAAAAATAATTGAGATTGCATGTTTTTAAGAGAGAAGAAATAAGAGATAATTTGGACC[G/A]
TAGATCTATCATCCAAAGGTTAGAAATAATTGGAGTGATGTGGCTTAATGGGAGAAGAGAGAAATAGCATTAACTACACTTAGTGGGGATGAACTATATA
TATATAGTTCATCCCCACTAAGTGTAGTTAATGCTATTTCTCTCTTCTCCCATTAAGCCACATCACTCCAATTATTTCTAACCTTTGGATGATAGATCTA[C/T]
GGTCCAAATTATCTCTTATTTCTTCTCTCTTAAAAACATGCAATCTCAATTATTTTTAGTCTTAAAATTGTATCAAATTGTTTTGTTTTTATAATCAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.60% | 5.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 69.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729253566 | G -> A | LOC_Os07g48880.1 | upstream_gene_variant ; 1596.0bp to feature; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0729253566 | G -> A | LOC_Os07g48890.1 | upstream_gene_variant ; 880.0bp to feature; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0729253566 | G -> A | LOC_Os07g48880.3 | upstream_gene_variant ; 1596.0bp to feature; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0729253566 | G -> A | LOC_Os07g48880.4 | upstream_gene_variant ; 1596.0bp to feature; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0729253566 | G -> A | LOC_Os07g48880.2 | upstream_gene_variant ; 1596.0bp to feature; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0729253566 | G -> A | LOC_Os07g48880-LOC_Os07g48890 | intergenic_region ; MODIFIER | silent_mutation | Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729253566 | 9.66E-08 | 9.66E-08 | mr1008 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | 4.37E-07 | 4.37E-07 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 6.03E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 1.64E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 6.12E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 4.42E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 6.68E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 1.49E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 1.43E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 3.81E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 3.71E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 1.81E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 5.88E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729253566 | NA | 5.72E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |