Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729253566:

Variant ID: vg0729253566 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29253566
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGATTATAAAAACAAAACAATTTGATACAATTTTAAGACTAAAAATAATTGAGATTGCATGTTTTTAAGAGAGAAGAAATAAGAGATAATTTGGACC[G/A]
TAGATCTATCATCCAAAGGTTAGAAATAATTGGAGTGATGTGGCTTAATGGGAGAAGAGAGAAATAGCATTAACTACACTTAGTGGGGATGAACTATATA

Reverse complement sequence

TATATAGTTCATCCCCACTAAGTGTAGTTAATGCTATTTCTCTCTTCTCCCATTAAGCCACATCACTCCAATTATTTCTAACCTTTGGATGATAGATCTA[C/T]
GGTCCAAATTATCTCTTATTTCTTCTCTCTTAAAAACATGCAATCTCAATTATTTTTAGTCTTAAAATTGTATCAAATTGTTTTGTTTTTATAATCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.90%	0.02%	0.00%	NA
All Indica	2759	94.60%	5.40%	0.04%	0.00%	NA
All Japonica	1512	14.50%	85.50%	0.00%	0.00%	NA
Aus	269	85.10%	14.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	92.70%	7.10%	0.22%	0.00%	NA
Indica III	913	94.40%	5.60%	0.00%	0.00%	NA
Indica Intermediate	786	92.20%	7.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	26.60%	73.40%	0.00%	0.00%	NA
Japonica Intermediate	241	30.70%	69.30%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729253566	G -> A	LOC_Os07g48880.1	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0729253566	G -> A	LOC_Os07g48890.1	upstream_gene_variant ; 880.0bp to feature; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0729253566	G -> A	LOC_Os07g48880.3	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0729253566	G -> A	LOC_Os07g48880.4	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0729253566	G -> A	LOC_Os07g48880.2	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0729253566	G -> A	LOC_Os07g48880-LOC_Os07g48890	intergenic_region ; MODIFIER	silent_mutation	Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729253566	9.66E-08	9.66E-08	mr1008	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	4.37E-07	4.37E-07	mr1009	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	6.03E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	1.64E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	6.12E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	4.42E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	6.68E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	1.49E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	1.43E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	3.81E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	3.71E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	1.81E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	5.88E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566	NA	5.72E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251