\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729253566:

Variant ID: vg0729253566 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29253566
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGATTATAAAAACAAAACAATTTGATACAATTTTAAGACTAAAAATAATTGAGATTGCATGTTTTTAAGAGAGAAGAAATAAGAGATAATTTGGACC[G/A]
TAGATCTATCATCCAAAGGTTAGAAATAATTGGAGTGATGTGGCTTAATGGGAGAAGAGAGAAATAGCATTAACTACACTTAGTGGGGATGAACTATATA

Reverse complement sequence

TATATAGTTCATCCCCACTAAGTGTAGTTAATGCTATTTCTCTCTTCTCCCATTAAGCCACATCACTCCAATTATTTCTAACCTTTGGATGATAGATCTA[C/T]
GGTCCAAATTATCTCTTATTTCTTCTCTCTTAAAAACATGCAATCTCAATTATTTTTAGTCTTAAAATTGTATCAAATTGTTTTGTTTTTATAATCAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.90% 0.02% 0.00% NA
All Indica  2759 94.60% 5.40% 0.04% 0.00% NA
All Japonica  1512 14.50% 85.50% 0.00% 0.00% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.80% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 26.60% 73.40% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 69.30% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729253566 G -> A LOC_Os07g48880.1 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0729253566 G -> A LOC_Os07g48890.1 upstream_gene_variant ; 880.0bp to feature; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0729253566 G -> A LOC_Os07g48880.3 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0729253566 G -> A LOC_Os07g48880.4 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0729253566 G -> A LOC_Os07g48880.2 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0729253566 G -> A LOC_Os07g48880-LOC_Os07g48890 intergenic_region ; MODIFIER silent_mutation Average:48.195; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729253566 9.66E-08 9.66E-08 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 4.37E-07 4.37E-07 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 6.03E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 1.64E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 6.12E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 4.42E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 6.68E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 1.49E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 1.43E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 3.81E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 3.71E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 1.81E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 5.88E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729253566 NA 5.72E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251