Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729240175:

Variant ID: vg0729240175 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29240175
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATTGAGTACATGCTTGTGTTAATTGCTTCACGGTTGGTTGAGCCTGGATTTTTATTTTTCGGTGATGAGCACTTAGTAGCAGCTATTAGTTGTAGATA[T/A]
AGCAATTACCAAAAGTAGATGGGTTTTCGTTCCTACAAAGAATGTTCGCTCACTCAAATAATCATAATTATTTTAAGATAGATCAATATGATTTATATTG

Reverse complement sequence

CAATATAAATCATATTGATCTATCTTAAAATAATTATGATTATTTGAGTGAGCGAACATTCTTTGTAGGAACGAAAACCCATCTACTTTTGGTAATTGCT[A/T]
TATCTACAACTAATAGCTGCTACTAAGTGCTCATCACCGAAAAATAAAAATCCAGGCTCAACCAACCGTGAAGCAATTAACACAAGCATGTACTCAATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.90% 0.06% 0.00% NA
All Indica  2759 96.10% 3.80% 0.07% 0.00% NA
All Japonica  1512 26.30% 73.70% 0.00% 0.00% NA
Aus  269 70.60% 29.00% 0.37% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 92.80% 7.20% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 59.90% 40.10% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729240175 T -> A LOC_Os07g48870.1 upstream_gene_variant ; 1913.0bp to feature; MODIFIER silent_mutation Average:30.461; most accessible tissue: Callus, score: 57.854 N N N N
vg0729240175 T -> A LOC_Os07g48850-LOC_Os07g48870 intergenic_region ; MODIFIER silent_mutation Average:30.461; most accessible tissue: Callus, score: 57.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729240175 NA 5.60E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 2.00E-25 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 1.07E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 9.22E-10 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 3.02E-06 mr1324_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 6.99E-06 6.99E-06 mr1326_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 6.69E-06 6.69E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 7.91E-09 mr1338_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 2.55E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 2.66E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 2.44E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 9.58E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 9.49E-07 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 2.80E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 3.12E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 4.70E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729240175 NA 1.56E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251