\
| Variant ID: vg0729234628 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29234628 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )
CAACAACAATACAATTATAGCGATCGATCGAGATGTGACCCCTTATTTTGGTCAGAGCATCTCCTGTTTCGTTCTTCGATATATTCCTGTCTCCTAATTT[C/G]
TTGTTCTTCTCCAACCCACTAACACTACGACTTAAAGATTCATTTGCATCATGTCTAGTGTGTTTTACTGGTCTTGGAGTGGCACTAATTGGGTTCGTTT
AAACGAACCCAATTAGTGCCACTCCAAGACCAGTAAAACACACTAGACATGATGCAAATGAATCTTTAAGTCGTAGTGTTAGTGGGTTGGAGAAGAACAA[G/C]
AAATTAGGAGACAGGAATATATCGAAGAACGAAACAGGAGATGCTCTGACCAAAATAAGGGGTCACATCTCGATCGATCGCTATAATTGTATTGTTGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 17.10% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 50.30% | 49.00% | 0.66% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 21.30% | 78.00% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 83.90% | 15.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 26.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729234628 | C -> G | LOC_Os07g48850.1 | upstream_gene_variant ; 1740.0bp to feature; MODIFIER | silent_mutation | Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg0729234628 | C -> G | LOC_Os07g48850.2 | upstream_gene_variant ; 1868.0bp to feature; MODIFIER | silent_mutation | Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg0729234628 | C -> G | LOC_Os07g48850-LOC_Os07g48870 | intergenic_region ; MODIFIER | silent_mutation | Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729234628 | NA | 8.42E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | NA | 8.81E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | NA | 1.49E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 9.58E-06 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | NA | 9.54E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 2.14E-09 | NA | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 3.90E-06 | NA | mr1679_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 3.84E-06 | NA | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 2.86E-06 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729234628 | 1.60E-06 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |