Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729234628:

Variant ID: vg0729234628 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29234628
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

CAACAACAATACAATTATAGCGATCGATCGAGATGTGACCCCTTATTTTGGTCAGAGCATCTCCTGTTTCGTTCTTCGATATATTCCTGTCTCCTAATTT[C/G]
TTGTTCTTCTCCAACCCACTAACACTACGACTTAAAGATTCATTTGCATCATGTCTAGTGTGTTTTACTGGTCTTGGAGTGGCACTAATTGGGTTCGTTT

Reverse complement sequence

AAACGAACCCAATTAGTGCCACTCCAAGACCAGTAAAACACACTAGACATGATGCAAATGAATCTTTAAGTCGTAGTGTTAGTGGGTTGGAGAAGAACAA[G/C]
AAATTAGGAGACAGGAATATATCGAAGAACGAAACAGGAGATGCTCTGACCAAAATAAGGGGTCACATCTCGATCGATCGCTATAATTGTATTGTTGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.10%	0.25%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	50.30%	49.00%	0.66%	0.00%	NA
Aus	269	89.60%	10.00%	0.37%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	21.30%	78.00%	0.78%	0.00%	NA
Tropical Japonica	504	83.90%	15.90%	0.20%	0.00%	NA
Japonica Intermediate	241	72.60%	26.10%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729234628	C -> G	LOC_Os07g48850.1	upstream_gene_variant ; 1740.0bp to feature; MODIFIER	silent_mutation	Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg0729234628	C -> G	LOC_Os07g48850.2	upstream_gene_variant ; 1868.0bp to feature; MODIFIER	silent_mutation	Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg0729234628	C -> G	LOC_Os07g48850-LOC_Os07g48870	intergenic_region ; MODIFIER	silent_mutation	Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729234628	NA	8.42E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	NA	8.81E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	NA	1.49E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	9.58E-06	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	NA	9.54E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	2.14E-09	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	3.90E-06	NA	mr1679_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	3.84E-06	NA	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	2.86E-06	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628	1.60E-06	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251