\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729234628:

Variant ID: vg0729234628 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29234628
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


CAACAACAATACAATTATAGCGATCGATCGAGATGTGACCCCTTATTTTGGTCAGAGCATCTCCTGTTTCGTTCTTCGATATATTCCTGTCTCCTAATTT[C/G]
TTGTTCTTCTCCAACCCACTAACACTACGACTTAAAGATTCATTTGCATCATGTCTAGTGTGTTTTACTGGTCTTGGAGTGGCACTAATTGGGTTCGTTT

Reverse complement sequence

AAACGAACCCAATTAGTGCCACTCCAAGACCAGTAAAACACACTAGACATGATGCAAATGAATCTTTAAGTCGTAGTGTTAGTGGGTTGGAGAAGAACAA[G/C]
AAATTAGGAGACAGGAATATATCGAAGAACGAAACAGGAGATGCTCTGACCAAAATAAGGGGTCACATCTCGATCGATCGCTATAATTGTATTGTTGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.10% 0.25% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 50.30% 49.00% 0.66% 0.00% NA
Aus  269 89.60% 10.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 21.30% 78.00% 0.78% 0.00% NA
Tropical Japonica  504 83.90% 15.90% 0.20% 0.00% NA
Japonica Intermediate  241 72.60% 26.10% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729234628 C -> G LOC_Os07g48850.1 upstream_gene_variant ; 1740.0bp to feature; MODIFIER silent_mutation Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N
vg0729234628 C -> G LOC_Os07g48850.2 upstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N
vg0729234628 C -> G LOC_Os07g48850-LOC_Os07g48870 intergenic_region ; MODIFIER silent_mutation Average:57.841; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729234628 NA 8.42E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 NA 8.81E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 NA 1.49E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 9.58E-06 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 NA 9.54E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 2.14E-09 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 3.90E-06 NA mr1679_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 3.84E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 2.86E-06 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729234628 1.60E-06 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251