Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729155105:

Variant ID: vg0729155105 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29155105
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCACAAGCTTCAAAGCCACATGGACAGAGAACAGGCACACCTATCTTAATTTGATTCTTTTATACTCCCTCCATCCCATAAAAAATCAATCTAAGATC[A/C]
AATGTGACATATTTTAGTACTATAAATTTGAAAACATCTGCTAAAATATGTTATATCATCAGATATTAAGTTGGTTTTTTATTGGACGGAAGGAGTATGT

Reverse complement sequence

ACATACTCCTTCCGTCCAATAAAAAACCAACTTAATATCTGATGATATAACATATTTTAGCAGATGTTTTCAAATTTATAGTACTAAAATATGTCACATT[T/G]
GATCTTAGATTGATTTTTTATGGGATGGAGGGAGTATAAAAGAATCAAATTAAGATAGGTGTGCCTGTTCTCTGTCCATGTGGCTTTGAAGCTTGTGAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.00% 0.30% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 86.70% 12.40% 0.93% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 81.50% 16.90% 1.56% 0.00% NA
Tropical Japonica  504 94.60% 5.20% 0.20% 0.00% NA
Japonica Intermediate  241 86.70% 12.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729155105 A -> C LOC_Os07g48670.1 upstream_gene_variant ; 3778.0bp to feature; MODIFIER silent_mutation Average:56.06; most accessible tissue: Callus, score: 76.47 N N N N
vg0729155105 A -> C LOC_Os07g48680.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:56.06; most accessible tissue: Callus, score: 76.47 N N N N
vg0729155105 A -> C LOC_Os07g48700.1 downstream_gene_variant ; 876.0bp to feature; MODIFIER silent_mutation Average:56.06; most accessible tissue: Callus, score: 76.47 N N N N
vg0729155105 A -> C LOC_Os07g48680-LOC_Os07g48700 intergenic_region ; MODIFIER silent_mutation Average:56.06; most accessible tissue: Callus, score: 76.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729155105 1.30E-07 3.18E-14 Awn_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0729155105 NA 7.02E-14 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0729155105 NA 5.55E-09 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 4.67E-06 1.09E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 5.52E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 3.57E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 1.01E-09 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 1.83E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 6.98E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729155105 NA 4.39E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251