\
| Variant ID: vg0729072157 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29072157 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCGGTTTCATTTATGTCTGATTGGTAAAACTTCAGCTCCAGCTTCATCTTTTCTGAAGCTAGAGTCCATCAAACGGTTTCAATTTCACCTAAAAAGAAAG[C/T]
GGAGGGACTAAAGTGCTATCACATAATGAACTAGCGACATGAAGCGGGTTTCAGACTGTTCCACAACTCCATTTCAGAACAAAAAATGCACCTTTTCACA
TGTGAAAAGGTGCATTTTTTGTTCTGAAATGGAGTTGTGGAACAGTCTGAAACCCGCTTCATGTCGCTAGTTCATTATGTGATAGCACTTTAGTCCCTCC[G/A]
CTTTCTTTTTAGGTGAAATTGAAACCGTTTGATGGACTCTAGCTTCAGAAAAGATGAAGCTGGAGCTGAAGTTTTACCAATCAGACATAAATGAAACCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 1.20% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 3.60% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.20% | 6.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729072157 | C -> T | LOC_Os07g48560.1 | upstream_gene_variant ; 886.0bp to feature; MODIFIER | silent_mutation | Average:58.429; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0729072157 | C -> T | LOC_Os07g48550-LOC_Os07g48560 | intergenic_region ; MODIFIER | silent_mutation | Average:58.429; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729072157 | NA | 9.51E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729072157 | NA | 1.53E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729072157 | NA | 1.76E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729072157 | 2.66E-06 | 3.80E-08 | mr1679_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729072157 | NA | 6.38E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729072157 | NA | 2.79E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |