\
| Variant ID: vg0729064560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29064560 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATATGAGATGTGACATATTCTACGAGAAACGCTCAGGGGTCTTCCGGCTAGCTCCACTGGATGGTGGGCTAGCCGGCCTGGGTTTGAAGTCTCTCATC[T/C]
ATTCTATTTATTTGATATTAGATCTTTTAATATTTGTGTTTTTTTAATTCTAGTACTACGAATTTAAATAGAGTTGTATCGGTGATATAGGCCCAGGGAT
ATCCCTGGGCCTATATCACCGATACAACTCTATTTAAATTCGTAGTACTAGAATTAAAAAAACACAAATATTAAAAGATCTAATATCAAATAAATAGAAT[A/G]
GATGAGAGACTTCAAACCCAGGCCGGCTAGCCCACCATCCAGTGGAGCTAGCCGGAAGACCCCTGAGCGTTTCTCGTAGAATATGTCACATCTCATATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 21.30% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 38.10% | 61.20% | 0.73% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 8.70% | 90.20% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 63.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729064560 | T -> C | LOC_Os07g48550-LOC_Os07g48560 | intergenic_region ; MODIFIER | silent_mutation | Average:61.944; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729064560 | NA | 8.47E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 6.39E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 2.20E-39 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 4.66E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 4.09E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 7.59E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 3.49E-06 | mr1386_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 1.82E-09 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | 1.33E-08 | NA | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | 2.21E-06 | NA | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | 4.12E-06 | NA | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | 4.66E-06 | NA | mr1720_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729064560 | NA | 2.25E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |