\
| Variant ID: vg0729047751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29047751 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 200. )
AGCCGGAATATATAATTTGTTTTGATATTAGTATACGTTTAATACTTAAAATGTGCGTCCGTATACTTTAAAAACTTTACACCCAAATAACTAAACACAC[C/T]
CTTGATGTATACTACTTTCGTCCCAAAATATAATAACTTTTGGCTATGAATCTGGATATATAGTTGTCTATACTTATAGCTAAAATTGCTTATATTTTGG
CCAAAATATAAGCAATTTTAGCTATAAGTATAGACAACTATATATCCAGATTCATAGCCAAAAGTTATTATATTTTGGGACGAAAGTAGTATACATCAAG[G/A]
GTGTGTTTAGTTATTTGGGTGTAAAGTTTTTAAAGTATACGGACGCACATTTTAAGTATTAAACGTATACTAATATCAAAACAAATTATATATTCCGGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 1.20% | 0.68% | 9.84% | NA |
| All Indica | 2759 | 94.90% | 2.00% | 0.69% | 2.43% | NA |
| All Japonica | 1512 | 74.20% | 0.00% | 0.86% | 24.93% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 92.10% | 6.10% | 1.85% | 0.00% | NA |
| Indica II | 465 | 94.00% | 0.60% | 0.43% | 4.95% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 92.40% | 1.50% | 0.76% | 5.34% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 25.80% | 0.00% | 2.18% | 72.02% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 0.83% | 5.81% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729047751 | C -> DEL | N | N | silent_mutation | Average:57.14; most accessible tissue: Callus, score: 94.157 | N | N | N | N |
| vg0729047751 | C -> T | LOC_Os07g48550-LOC_Os07g48560 | intergenic_region ; MODIFIER | silent_mutation | Average:57.14; most accessible tissue: Callus, score: 94.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729047751 | NA | 7.13E-08 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 3.98E-08 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 7.69E-08 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 4.34E-09 | mr1585 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 9.70E-07 | mr1765 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 1.46E-07 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 1.46E-07 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729047751 | NA | 1.32E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |