\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729047751:

Variant ID: vg0729047751 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29047751
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCGGAATATATAATTTGTTTTGATATTAGTATACGTTTAATACTTAAAATGTGCGTCCGTATACTTTAAAAACTTTACACCCAAATAACTAAACACAC[C/T]
CTTGATGTATACTACTTTCGTCCCAAAATATAATAACTTTTGGCTATGAATCTGGATATATAGTTGTCTATACTTATAGCTAAAATTGCTTATATTTTGG

Reverse complement sequence

CCAAAATATAAGCAATTTTAGCTATAAGTATAGACAACTATATATCCAGATTCATAGCCAAAAGTTATTATATTTTGGGACGAAAGTAGTATACATCAAG[G/A]
GTGTGTTTAGTTATTTGGGTGTAAAGTTTTTAAAGTATACGGACGCACATTTTAAGTATTAAACGTATACTAATATCAAAACAAATTATATATTCCGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 1.20% 0.68% 9.84% NA
All Indica  2759 94.90% 2.00% 0.69% 2.43% NA
All Japonica  1512 74.20% 0.00% 0.86% 24.93% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 92.10% 6.10% 1.85% 0.00% NA
Indica II  465 94.00% 0.60% 0.43% 4.95% NA
Indica III  913 99.30% 0.40% 0.00% 0.22% NA
Indica Intermediate  786 92.40% 1.50% 0.76% 5.34% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 25.80% 0.00% 2.18% 72.02% NA
Japonica Intermediate  241 93.40% 0.00% 0.83% 5.81% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 82.20% 0.00% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729047751 C -> DEL N N silent_mutation Average:57.14; most accessible tissue: Callus, score: 94.157 N N N N
vg0729047751 C -> T LOC_Os07g48550-LOC_Os07g48560 intergenic_region ; MODIFIER silent_mutation Average:57.14; most accessible tissue: Callus, score: 94.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729047751 NA 7.13E-08 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 3.98E-08 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 7.69E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 4.34E-09 mr1585 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 9.70E-07 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 1.46E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 1.46E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729047751 NA 1.32E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251