\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729024509:

Variant ID: vg0729024509 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29024509
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.05, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGTGACATCTATACTAATATAAAAAGGAGTTCACCTCTAGCAATCCTACCGGACAAATCATCCATCTCATCTCATTCGTCCATCCGCCATCTCATCTA[A/T]
TCTCATCCGTCCATCGCTATCCCCTATCCTCCTCGCTGTAGGAAATCATCATCACCAATCCCACCTGATTCCTCTCCACCGCGCTTTCCGCCCGCGCGAT

Reverse complement sequence

ATCGCGCGGGCGGAAAGCGCGGTGGAGAGGAATCAGGTGGGATTGGTGATGATGATTTCCTACAGCGAGGAGGATAGGGGATAGCGATGGACGGATGAGA[T/A]
TAGATGAGATGGCGGATGGACGAATGAGATGAGATGGATGATTTGTCCGGTAGGATTGCTAGAGGTGAACTCCTTTTTATATTAGTATAGATGTCACTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 34.40% 0.08% 0.99% NA
All Indica  2759 96.00% 4.00% 0.00% 0.00% NA
All Japonica  1512 7.10% 89.70% 0.20% 3.04% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 84.30% 0.60% 9.13% NA
Japonica Intermediate  241 27.40% 72.60% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729024509 A -> DEL N N silent_mutation Average:97.717; most accessible tissue: Zhenshan97 flower, score: 99.123 N N N N
vg0729024509 A -> T LOC_Os07g48520.1 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:97.717; most accessible tissue: Zhenshan97 flower, score: 99.123 N N N N
vg0729024509 A -> T LOC_Os07g48520.2 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:97.717; most accessible tissue: Zhenshan97 flower, score: 99.123 N N N N
vg0729024509 A -> T LOC_Os07g48520.3 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:97.717; most accessible tissue: Zhenshan97 flower, score: 99.123 N N N N
vg0729024509 A -> T LOC_Os07g48510-LOC_Os07g48520 intergenic_region ; MODIFIER silent_mutation Average:97.717; most accessible tissue: Zhenshan97 flower, score: 99.123 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0729024509 A T -0.06 0.01 0.02 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729024509 3.86E-06 3.86E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 1.27E-06 1.27E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 4.21E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 2.01E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 5.80E-06 mr1336 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 6.09E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 1.68E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 2.30E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 4.60E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 8.56E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 2.18E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 2.10E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 3.96E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 3.55E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 6.67E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 7.03E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 1.87E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729024509 NA 1.96E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251