Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728979771:

Variant ID: vg0728979771 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28979771
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCTCTCCTTATCTTAGTTTGATCTTTTATTTCGTTGGGTGTGTTTAATTCATTTGAACTACACTCAGTGTTTGGGTGTTACTTTTATAATAATTGGCT[A/G,C]
TAGCTCTGATGAGCAAAGGCCGGGATGTTTTATTCTATTATTGTAGCGCCCGTTCCGTCGTGGCGCCTAGCGGAAAAATTATCTCTTAAAAACCCTAATT

Reverse complement sequence

AATTAGGGTTTTTAAGAGATAATTTTTCCGCTAGGCGCCACGACGGAACGGGCGCTACAATAATAGAATAAAACATCCCGGCCTTTGCTCATCAGAGCTA[T/C,G]
AGCCAATTATTATAAAAGTAACACCCAAACACTGAGTGTAGTTCAAATGAATTAAACACACCCAACGAAATAAAAGATCAAACTAAGATAAGGAGAGCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	28.50%	7.17%	0.00%	C: 0.02%
All Indica	2759	82.30%	6.70%	10.91%	0.00%	NA
All Japonica	1512	30.90%	67.30%	1.85%	0.00%	NA
Aus	269	81.40%	17.10%	1.49%	0.00%	NA
Indica I	595	88.10%	3.00%	8.91%	0.00%	NA
Indica II	465	83.20%	6.50%	10.32%	0.00%	NA
Indica III	913	79.70%	8.80%	11.50%	0.00%	NA
Indica Intermediate	786	80.50%	7.40%	12.09%	0.00%	NA
Temperate Japonica	767	1.30%	98.40%	0.26%	0.00%	NA
Tropical Japonica	504	74.40%	21.00%	4.56%	0.00%	NA
Japonica Intermediate	241	34.00%	64.70%	1.24%	0.00%	NA
VI/Aromatic	96	30.20%	67.70%	2.08%	0.00%	NA
Intermediate	90	56.70%	37.80%	4.44%	0.00%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728979771	A -> G	LOC_Os07g48440-LOC_Os07g48450	intergenic_region ; MODIFIER	silent_mutation	Average:11.542; most accessible tissue: Zhenshan97 flower, score: 16.6	N	N	N	N
vg0728979771	A -> C	LOC_Os07g48440-LOC_Os07g48450	intergenic_region ; MODIFIER	silent_mutation	Average:11.542; most accessible tissue: Zhenshan97 flower, score: 16.6	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728979771	NA	2.99E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	3.71E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	1.70E-10	mr1347_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	3.56E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	4.15E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	4.17E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	1.36E-11	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	4.53E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	5.84E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	6.64E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	9.62E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728979771	NA	5.93E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251