\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728961881:

Variant ID: vg0728961881 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28961881
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, C: 0.29, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTGTCAAATCTCTTTTTTGTTTTTTTTTCTTTCAGGAGGTTTTATCTTATTTTTTCCCATTTTGCAAACAAAATCATTGTCGACATCTACTCATCTG[C/A]
CCGGGAATATAGGGGATTATTTCTCCTTCATTTGTCCAAGAATATAGACGATTTTTGTTATACTGAGGCAACAAGGGCAGCAACAAACTGATTTCAGCAT

Reverse complement sequence

ATGCTGAAATCAGTTTGTTGCTGCCCTTGTTGCCTCAGTATAACAAAAATCGTCTATATTCTTGGACAAATGAAGGAGAAATAATCCCCTATATTCCCGG[G/T]
CAGATGAGTAGATGTCGACAATGATTTTGTTTGCAAAATGGGAAAAAATAAGATAAAACCTCCTGAAAGAAAAAAAAACAAAAAAGAGATTTGACAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 26.30% 16.31% 4.10% NA
All Indica  2759 34.00% 36.30% 23.60% 6.13% NA
All Japonica  1512 92.70% 4.00% 2.65% 0.66% NA
Aus  269 16.00% 58.70% 19.70% 5.58% NA
Indica I  595 63.50% 16.00% 17.98% 2.52% NA
Indica II  465 54.40% 20.90% 20.00% 4.73% NA
Indica III  913 6.10% 57.60% 26.29% 9.97% NA
Indica Intermediate  786 31.90% 36.00% 26.84% 5.22% NA
Temperate Japonica  767 99.30% 0.30% 0.39% 0.00% NA
Tropical Japonica  504 91.70% 3.20% 4.56% 0.60% NA
Japonica Intermediate  241 73.40% 17.80% 5.81% 2.90% NA
VI/Aromatic  96 77.10% 11.50% 11.46% 0.00% NA
Intermediate  90 70.00% 12.20% 17.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728961881 C -> DEL N N silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48420.1 upstream_gene_variant ; 1053.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48430.1 upstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48420.2 upstream_gene_variant ; 1053.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48420.3 upstream_gene_variant ; 1053.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48430.3 upstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48430.2 upstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48430.4 upstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N
vg0728961881 C -> A LOC_Os07g48420-LOC_Os07g48430 intergenic_region ; MODIFIER silent_mutation Average:81.475; most accessible tissue: Minghui63 flower, score: 91.386 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728961881 C A -0.01 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728961881 NA 7.26E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728961881 NA 1.59E-09 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728961881 NA 8.38E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.50E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 7.87E-06 7.87E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 5.88E-06 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 9.06E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.22E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 9.79E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.36E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.18E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 5.11E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 6.98E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 5.55E-07 mr1522 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.87E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 8.03E-08 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 8.36E-09 NA mr1971 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.95E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.87E-08 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.57E-09 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 7.52E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.55E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 5.62E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.05E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 4.09E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.97E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.32E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.95E-09 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.41E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 4.12E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.95E-09 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 8.64E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.71E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.86E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.93E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.90E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 4.05E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.04E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.07E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.28E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.95E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 9.73E-09 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 9.66E-08 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.88E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.69E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 3.68E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 7.13E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 1.27E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 2.71E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 4.52E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 7.93E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961881 NA 8.10E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251