Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0728961714:

Variant ID: vg0728961714 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 28961714
Reference Allele: G	Alternative Allele: GT,A
Primary Allele: G	Secondary Allele: GT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACTTTTGCCCTCGGCCTAGTAACTCCTTTGACTCGGTGGGCTATGGAATTTTGTCAAATCTCTTTTTTGTTTTTTTTTCTTTCAGGAGGTTTTATCTT[G/GT,A]
TTTTTTTTCCCATTTTGCAAACAAAACGTATTTCAAAATTTTCTATCACGATACCTGGGCTATGGAATTTTGTCAAATCTCTTTTTTGTTTTTTTTTCTT

Reverse complement sequence

AAGAAAAAAAAACAAAAAAGAGATTTGACAAAATTCCATAGCCCAGGTATCGTGATAGAAAATTTTGAAATACGTTTTGTTTGCAAAATGGGAAAAAAAA[C/AC,T]
AAGATAAAACCTCCTGAAAGAAAAAAAAACAAAAAAGAGATTTGACAAAATTCCATAGCCCACCGAGTCAAAGGAGTTACTAGGCCGAGGGCAAAAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	12.50%	30.89%	11.32%	A: 1.50%
All Indica	2759	15.60%	21.00%	44.33%	17.18%	A: 1.85%
All Japonica	1512	94.20%	0.50%	3.57%	1.52%	A: 0.20%
Aus	269	26.80%	0.40%	58.36%	9.67%	A: 4.83%
Indica I	595	4.40%	52.10%	28.74%	14.79%	NA
Indica II	465	11.60%	29.00%	40.86%	16.77%	A: 1.72%
Indica III	913	22.60%	0.10%	55.53%	19.17%	A: 2.63%
Indica Intermediate	786	18.40%	17.00%	45.17%	16.92%	A: 2.42%
Temperate Japonica	767	98.70%	0.50%	0.26%	0.52%	NA
Tropical Japonica	504	95.80%	0.40%	2.38%	0.99%	A: 0.40%
Japonica Intermediate	241	76.80%	0.40%	16.60%	5.81%	A: 0.41%
VI/Aromatic	96	81.20%	1.00%	13.54%	2.08%	A: 2.08%
Intermediate	90	67.80%	4.40%	14.44%	11.11%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728961714	G -> DEL	N	N	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48420.1	upstream_gene_variant ; 887.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48430.1	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48420.2	upstream_gene_variant ; 887.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48420.3	upstream_gene_variant ; 887.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48430.3	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48430.2	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48430.4	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> GT	LOC_Os07g48420-LOC_Os07g48430	intergenic_region ; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48420.1	upstream_gene_variant ; 886.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48430.1	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48420.2	upstream_gene_variant ; 886.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48420.3	upstream_gene_variant ; 886.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48430.3	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48430.2	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48430.4	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N
vg0728961714	G -> A	LOC_Os07g48420-LOC_Os07g48430	intergenic_region ; MODIFIER	silent_mutation	Average:98.036; most accessible tissue: Callus, score: 98.899	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0728961714	G	A	-0.02	-0.01	-0.01	-0.01	-0.01	-0.01
vg0728961714	G	GT	0.02	0.0	0.02	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728961714	NA	3.08E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728961714	NA	1.33E-09	Spikelet_length	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728961714	NA	4.07E-09	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.84E-06	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	6.07E-11	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.73E-06	mr1005	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.55E-07	mr1011	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.42E-06	mr1012	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	8.14E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.47E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.50E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	3.18E-07	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	8.26E-18	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	2.55E-09	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.88E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.00E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	3.90E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.42E-08	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	2.35E-08	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.59E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.23E-07	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.52E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	3.96E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	7.96E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.57E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.83E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	2.05E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.82E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.33E-09	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.56E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	3.06E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	9.58E-07	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	2.18E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	6.39E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	4.37E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	4.81E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.33E-10	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	6.80E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	1.09E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.60E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	4.38E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.83E-09	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	5.31E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728961714	NA	7.37E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251