\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728918648:

Variant ID: vg0728918648 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28918648
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACTCCCAGGGTTCTGTTCTTCTTTAACCAAATTTGCTGCAGGACAATAAAAAATTATGTGATTTGTTAGTAGACATCAAAACGTGTCATTGCTGAAA[G/A]
ACACTTAAAAATTAATAATTTGCTGGAGGATAATTTTAACTCGATTGGAGAGAATTTCTTCTAAAAGACGATAATGTCTAGGATCGAAAGCTTTTGATCT

Reverse complement sequence

AGATCAAAAGCTTTCGATCCTAGACATTATCGTCTTTTAGAAGAAATTCTCTCCAATCGAGTTAAAATTATCCTCCAGCAAATTATTAATTTTTAAGTGT[C/T]
TTTCAGCAATGACACGTTTTGATGTCTACTAACAAATCACATAATTTTTTATTGTCCTGCAGCAAATTTGGTTAAAGAAGAACAGAACCCTGGGAGTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.30% 0.28% 0.00% NA
All Indica  2759 48.10% 51.60% 0.36% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 67.20% 32.80% 0.00% 0.00% NA
Indica II  465 65.20% 34.00% 0.86% 0.00% NA
Indica III  913 30.20% 69.70% 0.11% 0.00% NA
Indica Intermediate  786 44.10% 55.20% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728918648 G -> A LOC_Os07g48390.1 upstream_gene_variant ; 929.0bp to feature; MODIFIER silent_mutation Average:44.01; most accessible tissue: Callus, score: 73.677 N N N N
vg0728918648 G -> A LOC_Os07g48400.1 upstream_gene_variant ; 3625.0bp to feature; MODIFIER silent_mutation Average:44.01; most accessible tissue: Callus, score: 73.677 N N N N
vg0728918648 G -> A LOC_Os07g48370.1 downstream_gene_variant ; 4551.0bp to feature; MODIFIER silent_mutation Average:44.01; most accessible tissue: Callus, score: 73.677 N N N N
vg0728918648 G -> A LOC_Os07g48380.1 downstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:44.01; most accessible tissue: Callus, score: 73.677 N N N N
vg0728918648 G -> A LOC_Os07g48380-LOC_Os07g48390 intergenic_region ; MODIFIER silent_mutation Average:44.01; most accessible tissue: Callus, score: 73.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728918648 NA 7.99E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728918648 NA 9.92E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 8.73E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.46E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 1.55E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 7.65E-06 mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.21E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 8.53E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 1.24E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 3.53E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 6.12E-06 5.51E-11 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 6.14E-06 6.14E-06 mr1945 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 2.63E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 4.84E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.92E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 7.48E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.29E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 2.36E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 1.98E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 1.32E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.30E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 6.27E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 5.68E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 4.92E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 6.10E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918648 NA 8.25E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251