\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728918006:

Variant ID: vg0728918006 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 28918006
Reference Allele: TGACCGAGGAlternative Allele: TGGACCGAGG,GGACCGAGG,TTGGACCGAGG,AGACCGAGG,T
Primary Allele: TGACCGAGGSecondary Allele: GGACCGAGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAATTTCATATAAAACGGAAAGTCAAAATTTGGCACGGAAACCCACAGTTTGATTTTTTTTT[TGACCGAGG/TGGACCGAGG,GGACCGAGG,TTGGACCGAGG,AGACCGAGG,T]
GAGCAGGCAACAATTAAGTCTCACGTCACGCGCTGCGTATGGTACAAACCATGGTGAGAGTCCGAGCACTGCACGGTCGGATTGGGACCCATCGGCCATC

Reverse complement sequence

GATGGCCGATGGGTCCCAATCCGACCGTGCAGTGCTCGGACTCTCACCATGGTTTGTACCATACGCAGCGCGTGACGTGAGACTTAATTGTTGCCTGCTC[CCTCGGTCA/CCTCGGTCCA,CCTCGGTCC,CCTCGGTCCAA,CCTCGGTCT,A]
AAAAAAAAATCAAACTGTGGGTTTCCGTGCCAAATTTTGACTTTCCGTTTTATATGAAATTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAA

Allele Frequencies:

Populations Population SizeFrequency of TGACCGAGG(primary allele) Frequency of GGACCGAGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 33.70% 0.74% 0.55% TGGACCGAGG: 29.96%; AGACCGAGG: 0.04%; TTGGACCGAGG: 0.02%; T: 0.02%
All Indica  2759 3.40% 53.10% 0.87% 0.91% TGGACCGAGG: 41.57%; AGACCGAGG: 0.07%; TTGGACCGAGG: 0.04%; T: 0.04%
All Japonica  1512 92.70% 1.70% 0.26% 0.07% TGGACCGAGG: 5.29%
Aus  269 14.90% 19.00% 0.74% 0.00% TGGACCGAGG: 65.43%
Indica I  595 0.30% 32.60% 0.17% 0.00% TGGACCGAGG: 66.55%; AGACCGAGG: 0.34%
Indica II  465 6.00% 25.60% 0.86% 0.00% TGGACCGAGG: 67.53%
Indica III  913 1.30% 79.80% 0.77% 2.52% TGGACCGAGG: 15.33%; TTGGACCGAGG: 0.11%; T: 0.11%
Indica Intermediate  786 6.50% 53.90% 1.53% 0.25% TGGACCGAGG: 37.79%
Temperate Japonica  767 98.60% 0.10% 0.00% 0.00% TGGACCGAGG: 1.30%
Tropical Japonica  504 90.90% 4.40% 0.60% 0.20% TGGACCGAGG: 3.97%
Japonica Intermediate  241 77.60% 1.20% 0.41% 0.00% TGGACCGAGG: 20.75%
VI/Aromatic  96 71.90% 25.00% 0.00% 0.00% TGGACCGAGG: 3.12%
Intermediate  90 54.40% 28.90% 5.56% 0.00% TGGACCGAGG: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728918006 TGACCGAGG -> AGACCGAGG LOC_Os07g48380.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> AGACCGAGG LOC_Os07g48390.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> AGACCGAGG LOC_Os07g48400.1 upstream_gene_variant ; 4267.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> AGACCGAGG LOC_Os07g48370.1 downstream_gene_variant ; 3909.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> T LOC_Os07g48380.1 frameshift_variant&splice_acceptor_variant&splice_region_variant&intron_variant ; p.Ser34fs; HIGH splice_acceptor_variant Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> GGACCGAGG LOC_Os07g48380.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> GGACCGAGG LOC_Os07g48390.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> GGACCGAGG LOC_Os07g48400.1 upstream_gene_variant ; 4267.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> GGACCGAGG LOC_Os07g48370.1 downstream_gene_variant ; 3909.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TGGACCGAGG LOC_Os07g48380.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TGGACCGAGG LOC_Os07g48390.1 upstream_gene_variant ; 1569.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TGGACCGAGG LOC_Os07g48400.1 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> DEL N N silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TTGGACCGAGG LOC_Os07g48380.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TTGGACCGAGG LOC_Os07g48390.1 upstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TTGGACCGAGG LOC_Os07g48400.1 upstream_gene_variant ; 4266.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N
vg0728918006 TGACCGAGG -> TTGGACCGAGG LOC_Os07g48370.1 downstream_gene_variant ; 3910.0bp to feature; MODIFIER silent_mutation Average:79.364; most accessible tissue: Callus, score: 96.603 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728918006 TGACC* AGACC* 0.04 0.02 -0.03 0.02 0.04 0.06
vg0728918006 TGACC* GGACC* -0.01 -0.01 -0.02 0.04 0.06 0.08
vg0728918006 TGACC* T 0.0 -0.3 -0.25 -0.28 -0.3 -0.32
vg0728918006 TGACC* TGGAC* -0.03 -0.24 -0.21 0.05 0.03 0.07
vg0728918006 TGACC* TTGGA* 0.13 -0.5 -0.47 0.05 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728918006 NA 6.53E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728918006 NA 3.49E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728918006 NA 2.91E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 8.21E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 9.97E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 1.23E-08 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.36E-06 mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 6.04E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 1.01E-07 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.64E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.95E-08 mr1611 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 9.17E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 4.06E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 8.76E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 2.51E-06 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 6.18E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 9.81E-07 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 2.10E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 4.57E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 1.56E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.97E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 3.11E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 4.92E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 6.53E-08 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 2.12E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 1.07E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 9.97E-06 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 6.77E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 8.09E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.27E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 3.78E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 1.48E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 5.29E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728918006 NA 2.90E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251