Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0728880405:

Variant ID: vg0728880405 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28880405
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.23, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACAATAACATAGAAACATGCTTTATCTCTACCAAGGTTTACGATTCCGACAGGCCCTTTCGTTTCGGGCACTGGCGAAATTCGGAATTTCGCGAAAT[T/C]
CGGTAGAAAACCGGTAAATTCCAAATAAATTTCATAAACTAAAATTTGAATACAAATTCCCTGAGTTTGCCGACAAGTTTTAGCGAAATTCTGATCAAAA

Reverse complement sequence

TTTTGATCAGAATTTCGCTAAAACTTGTCGGCAAACTCAGGGAATTTGTATTCAAATTTTAGTTTATGAAATTTATTTGGAATTTACCGGTTTTCTACCG[A/G]
ATTTCGCGAAATTCCGAATTTCGCCAGTGCCCGAAACGAAAGGGCCTGTCGGAATCGTAAACCTTGGTAGAGATAAAGCATGTTTCTATGTTATTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 36.40% 0.97% 25.62% NA
All Indica  2759 4.10% 52.20% 1.59% 42.15% NA
All Japonica  1512 97.30% 0.40% 0.00% 2.31% NA
Aus  269 16.40% 83.30% 0.00% 0.37% NA
Indica I  595 0.30% 38.50% 0.34% 60.84% NA
Indica II  465 7.70% 32.00% 0.86% 59.35% NA
Indica III  913 1.80% 66.90% 3.72% 27.60% NA
Indica Intermediate  786 7.50% 57.30% 0.51% 34.73% NA
Temperate Japonica  767 98.80% 0.30% 0.00% 0.91% NA
Tropical Japonica  504 94.40% 0.20% 0.00% 5.36% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 71.90% 26.00% 0.00% 2.08% NA
Intermediate  90 60.00% 26.70% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728880405 T -> DEL N N silent_mutation Average:40.186; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0728880405 T -> C LOC_Os07g48330.1 upstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:40.186; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0728880405 T -> C LOC_Os07g48320.1 downstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:40.186; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0728880405 T -> C LOC_Os07g48320-LOC_Os07g48330 intergenic_region ; MODIFIER silent_mutation Average:40.186; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728880405 NA 1.09E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728880405 NA 1.63E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728880405 NA 5.00E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.08E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 4.66E-10 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.43E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.85E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.90E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.23E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.85E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 7.15E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.58E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.26E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 3.62E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 3.71E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.38E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.05E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.75E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 6.30E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.58E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.59E-11 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.06E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 6.09E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 7.12E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 4.81E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.93E-08 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.30E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.26E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 4.99E-06 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 3.08E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.50E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.23E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 7.94E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.69E-07 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 1.66E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 9.26E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.22E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.62E-12 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.14E-12 mr1653_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 8.73E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.69E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 2.74E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 7.45E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728880405 NA 5.97E-08 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251