\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728769587:

Variant ID: vg0728769587 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28769587
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.26, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAGTAAACATTTGCTAATGACGAATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTACAAACGAAATCTATAATTTGTTTTTGTCATTAGACTACA[A/T]
TTAATACTTTAAATATGTGTCCGTATATCTGATGTGACATATCAAAACTTTTCATCCCTGAAAAAGAGGACCTAAATGTGTCCGGCTGATTTTGTTTTAT

Reverse complement sequence

ATAAAACAAAATCAGCCGGACACATTTAGGTCCTCTTTTTCAGGGATGAAAAGTTTTGATATGTCACATCAGATATACGGACACATATTTAAAGTATTAA[T/A]
TGTAGTCTAATGACAAAAACAAATTATAGATTTCGTTTGTAAACTGCGAGACGAATTTATTAAGCCTAATTAATTCGTCATTAGCAAATGTTTACTGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.20% 0.17% 0.04% NA
All Indica  2759 92.60% 7.10% 0.22% 0.04% NA
All Japonica  1512 1.10% 98.80% 0.07% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 91.80% 7.10% 0.86% 0.22% NA
Indica III  913 92.80% 7.20% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.00% 0.25% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728769587 A -> DEL N N silent_mutation Average:48.92; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0728769587 A -> T LOC_Os07g48160.1 downstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:48.92; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0728769587 A -> T LOC_Os07g48170.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:48.92; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0728769587 A -> T LOC_Os07g48160-LOC_Os07g48170 intergenic_region ; MODIFIER silent_mutation Average:48.92; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728769587 NA 6.16E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.75E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 3.85E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 8.07E-06 2.09E-07 mr1837 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 3.64E-06 1.91E-08 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.50E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 6.15E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 5.51E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.93E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.94E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 7.10E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 4.51E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 3.34E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.85E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.38E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 4.57E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 6.85E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.64E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 3.47E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 9.96E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728769587 NA 1.66E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251