| Variant ID: vg0728763555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28763555 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.00, others allele: 0.00, population size: 250. )
AAGTGCAATGCAAACCTCAAGGTCTTTTATCTACTAAGCAAAAAAATGAAAATCCAAACCAAATGCAGCCCAACTGGGGACTTTTATCTAAACTACACCC[T/A]
CGTAGGTGCATTAGGCCCATTAGCAAAGTTCAGTCCCAACCTTAGTACCCGAAAACAAAGAAGAGTTTTTAACGTACAGGGCATAAACTTAAGAATATTC
GAATATTCTTAAGTTTATGCCCTGTACGTTAAAAACTCTTCTTTGTTTTCGGGTACTAAGGTTGGGACTGAACTTTGCTAATGGGCCTAATGCACCTACG[A/T]
GGGTGTAGTTTAGATAAAAGTCCCCAGTTGGGCTGCATTTGGTTTGGATTTTCATTTTTTTGCTTAGTAGATAAAAGACCTTGAGGTTTGCATTGCACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 38.70% | 0.25% | 0.17% | NA |
| All Indica | 2759 | 92.50% | 7.10% | 0.14% | 0.25% | NA |
| All Japonica | 1512 | 2.20% | 97.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.80% | 7.10% | 0.22% | 0.86% | NA |
| Indica III | 913 | 92.80% | 7.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 87.40% | 12.00% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 1.00% | 98.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 55.60% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728763555 | T -> DEL | N | N | silent_mutation | Average:96.014; most accessible tissue: Zhenshan97 flower, score: 99.016 | N | N | N | N |
| vg0728763555 | T -> A | LOC_Os07g48160.1 | upstream_gene_variant ; 868.0bp to feature; MODIFIER | silent_mutation | Average:96.014; most accessible tissue: Zhenshan97 flower, score: 99.016 | N | N | N | N |
| vg0728763555 | T -> A | LOC_Os07g48150.1 | downstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:96.014; most accessible tissue: Zhenshan97 flower, score: 99.016 | N | N | N | N |
| vg0728763555 | T -> A | LOC_Os07g48150-LOC_Os07g48160 | intergenic_region ; MODIFIER | silent_mutation | Average:96.014; most accessible tissue: Zhenshan97 flower, score: 99.016 | N | N | N | N |
For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.
| Var ID | Ref | Alt | Root (RT) | Young Leaf (YL) | Flag Leaf (FL) | Young Panicle (YP) | Lemma & Palea (LP) | Stamen & Pistil (SP) |
|---|---|---|---|---|---|---|---|---|
| vg0728763555 | T | A | -0.03 | -0.06 | -0.05 | -0.03 | -0.01 | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728763555 | NA | 2.67E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 3.33E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 2.59E-07 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | 3.64E-06 | 1.91E-08 | mr1837 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 8.62E-12 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 4.66E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 3.37E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 6.01E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 5.95E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 4.76E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 5.18E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 1.89E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 1.37E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 8.56E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728763555 | NA | 4.63E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |