\
| Variant ID: vg0728714849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28714849 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.09, others allele: 0.00, population size: 90. )
TCATGTTATATAATGTCTGTAGCATCAAATATATTATCACATGAGAAAAATCTGATATGGCAAGAGAGTTAACGAGGGGAGAGGTAAAAAGATGAAGAAA[A/C]
AATTTCTTATGCAAGAAACCATTTCTACACAAGAATTAAGAATGAAAACAAGAGGATAGGTAGATAAAAAAAAAAGATAAAGGAGATGATTAGATGATAA
TTATCATCTAATCATCTCCTTTATCTTTTTTTTTTATCTACCTATCCTCTTGTTTTCATTCTTAATTCTTGTGTAGAAATGGTTTCTTGCATAAGAAATT[T/G]
TTTCTTCATCTTTTTACCTCTCCCCTCGTTAACTCTCTTGCCATATCAGATTTTTCTCATGTGATAATATATTTGATGCTACAGACATTATATAACATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 14.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 85.80% | 14.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 13.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728714849 | A -> C | LOC_Os07g48090.1 | downstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:67.353; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| vg0728714849 | A -> C | LOC_Os07g48090-LOC_Os07g48100 | intergenic_region ; MODIFIER | silent_mutation | Average:67.353; most accessible tissue: Minghui63 flower, score: 83.493 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728714849 | NA | 1.32E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | 5.93E-07 | 5.93E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 4.23E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 2.01E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 1.39E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 5.25E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 6.72E-10 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728714849 | NA | 1.10E-07 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |