\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728682231:

Variant ID: vg0728682231 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28682231
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGTGGGACCCATGCTAGCCCGTGTGTTAGTAACTAACTCTTTCCTCCTCTCTCCCGCTCTCTCCTCTCTTCCCAATCCCCAACCAGGAAGCAGGTCGCA[A/G]
GCAGCGTGGATAAGGTTGGCAGCCGACGTCCAGCGGGTGTGTGGGGAGAAGGGCGGCCAAGCCCGATGCGATGCAAGGAGCCATGTCCAATTTGAGAATG

Reverse complement sequence

CATTCTCAAATTGGACATGGCTCCTTGCATCGCATCGGGCTTGGCCGCCCTTCTCCCCACACACCCGCTGGACGTCGGCTGCCAACCTTATCCACGCTGC[T/C]
TGCGACCTGCTTCCTGGTTGGGGATTGGGAAGAGAGGAGAGAGCGGGAGAGAGGAGGAAAGAGTTAGTTACTAACACACGGGCTAGCATGGGTCCCACGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 17.50% 0.42% 0.00% NA
All Indica  2759 98.10% 1.80% 0.11% 0.00% NA
All Japonica  1512 49.20% 50.10% 0.73% 0.00% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 2.80% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 13.80% 85.50% 0.65% 0.00% NA
Tropical Japonica  504 96.00% 3.60% 0.40% 0.00% NA
Japonica Intermediate  241 63.90% 34.40% 1.66% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728682231 A -> G LOC_Os07g48040.1 upstream_gene_variant ; 1887.0bp to feature; MODIFIER silent_mutation Average:92.591; most accessible tissue: Minghui63 flag leaf, score: 97.621 N N N N
vg0728682231 A -> G LOC_Os07g48030.1 downstream_gene_variant ; 2158.0bp to feature; MODIFIER silent_mutation Average:92.591; most accessible tissue: Minghui63 flag leaf, score: 97.621 N N N N
vg0728682231 A -> G LOC_Os07g48030-LOC_Os07g48040 intergenic_region ; MODIFIER silent_mutation Average:92.591; most accessible tissue: Minghui63 flag leaf, score: 97.621 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728682231 A G -0.04 -0.09 -0.04 -0.01 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728682231 NA 1.88E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 2.65E-07 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 8.81E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 2.64E-07 mr1047 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.32E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 9.75E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 2.73E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 6.30E-06 1.69E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 9.50E-07 1.08E-10 mr1543 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.68E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 9.16E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 4.18E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 2.84E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 9.86E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.08E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.83E-14 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 3.05E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.29E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 3.23E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 1.21E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728682231 NA 3.19E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251