Search for Variation information by Variation ID:
Detailed information for vg0728665353:
| Variant ID: vg0728665353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28665353 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
Flanking Sequence (100 bp) in Reference Genome:
CTTAACAAATTTTCTATAATAACCTGCTAAGCCCAGAAAGCCCCTCAACTTCTTGATAGTAGTTGGTTGGGTCCAATTAACTACATCTTGAATCTTTCGT[G/A]
GGTCAGTAGATACTCTTTGAACTCCTATCACGTGTCCTAAATAAGATATCTCTTGTTGAGCAAAGGAACACTTACTTAGTTTGACCTTCCACTGACTAGC
Reverse complement sequence
GCTAGTCAGTGGAAGGTCAAACTAAGTAAGTGTTCCTTTGCTCAACAAGAGATATCTTATTTAGGACACGTGATAGGAGTTCAAAGAGTATCTACTGACC[C/T]
ACGAAAGATTCAAGATGTAGTTAATTGGACCCAACCAACTACTATCAAGAAGTTGAGGGGCTTTCTGGGCTTAGCAGGTTATTATAGAAAATTTGTTAAG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 3.60% | 1.21% | 3.24% | NA |
| All Indica | 2759 | 87.70% | 6.00% | 1.96% | 4.35% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.13% | 0.60% | NA |
| Aus | 269 | 94.40% | 0.00% | 0.00% | 5.58% | NA |
| Indica I | 595 | 83.00% | 10.90% | 3.19% | 2.86% | NA |
| Indica II | 465 | 86.50% | 10.10% | 0.43% | 3.01% | NA |
| Indica III | 913 | 91.60% | 0.00% | 2.19% | 6.24% | NA |
| Indica Intermediate | 786 | 87.40% | 6.90% | 1.65% | 4.07% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 1.11% | 8.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728665353 | G -> DEL | LOC_Os07g48000.1 | N | frameshift_variant | Average:40.081; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| vg0728665353 | G -> A | LOC_Os07g48000.1 | missense_variant ; p.Pro844Leu; MODERATE | nonsynonymous_codon ; P844L | Average:40.081; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | probably damaging  |
2.037 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728665353 | 9.01E-08 | 9.12E-15 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | 1.56E-06 | 5.67E-14 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | 2.88E-08 | 2.04E-17 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | 1.08E-06 | 1.16E-15 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | NA | 3.30E-15 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | NA | 1.17E-13 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | NA | 2.19E-14 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728665353 | NA | 1.14E-13 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |