Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728551617:

Variant ID: vg0728551617 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 28551617
Reference Allele: T	Alternative Allele: G,TAG
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGTGATCATTTTTCAAACAAGTCCCTTGTTTGGATCGCTACGAACCTACGACTACGGATCAGACCGATCCGGAATTTTGCAGACAAACACCGTGTTTA[T/G,TAG]
TTCCAAAGTTTTTTTTTTCAAACTTCCAAGTTTTTCATCACATCAAAATTTTTCTACATACACAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTCA

Reverse complement sequence

TGAAATTGGAACGATGTGACGGAAAAGTTGGAAGTTTGTGTATGTAGAAAAATTTTGATGTGATGAAAAACTTGGAAGTTTGAAAAAAAAAACTTTGGAA[A/C,CTA]
TAAACACGGTGTTTGTCTGCAAAATTCCGGATCGGTCTGATCCGTAGTCGTAGGTTCGTAGCGATCCAAACAAGGGACTTGTTTGAAAAATGATCACCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.80%	0.15%	0.00%	TAG: 0.02%
All Indica	2759	97.20%	2.80%	0.07%	0.00%	NA
All Japonica	1512	42.90%	56.90%	0.26%	0.00%	NA
Aus	269	87.00%	12.60%	0.00%	0.00%	TAG: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.00%	2.80%	0.22%	0.00%	NA
Indica III	913	98.50%	1.40%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	6.40%	0.00%	0.00%	NA
Temperate Japonica	767	8.10%	91.70%	0.26%	0.00%	NA
Tropical Japonica	504	86.30%	13.50%	0.20%	0.00%	NA
Japonica Intermediate	241	62.70%	36.90%	0.41%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728551617	T -> TAG	LOC_Os07g47810.1	upstream_gene_variant ; 299.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> TAG	LOC_Os07g47820.1	upstream_gene_variant ; 1004.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> TAG	LOC_Os07g47820.2	upstream_gene_variant ; 1004.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> TAG	LOC_Os07g47810-LOC_Os07g47820	intergenic_region ; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> G	LOC_Os07g47810.1	upstream_gene_variant ; 298.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> G	LOC_Os07g47820.1	upstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> G	LOC_Os07g47820.2	upstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N
vg0728551617	T -> G	LOC_Os07g47810-LOC_Os07g47820	intergenic_region ; MODIFIER	silent_mutation	Average:69.58; most accessible tissue: Callus, score: 84.207	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728551617	NA	1.91E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	8.96E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	1.06E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	5.27E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	1.21E-09	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	5.13E-22	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	4.97E-06	6.79E-14	mr1361_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	9.38E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	3.50E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	3.00E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	1.44E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	9.17E-09	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	6.09E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	3.16E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	1.58E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	4.19E-09	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728551617	NA	3.52E-09	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251