\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728437840:

Variant ID: vg0728437840 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28437840
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACAACTCACCGGAGGGAAGAGATTCCTCAACTGAATTTCATTCAAAAGTGCAATAGTAGAAAGTACATATGAGAGATTACAATTTTACATAGGCAAA[G/T]
TCGTTTCAATTTCAGGTTAATTTGTATGCTCTAGGCAAAGTCACGTTCGTTCACAGGACGTAATGTAATCTTAACAACCATGTTTGTTGAAAATATTTTA

Reverse complement sequence

TAAAATATTTTCAACAAACATGGTTGTTAAGATTACATTACGTCCTGTGAACGAACGTGACTTTGCCTAGAGCATACAAATTAACCTGAAATTGAAACGA[C/A]
TTTGCCTATGTAAAATTGTAATCTCTCATATGTACTTTCTACTATTGCACTTTTGAATGAAATTCAGTTGAGGAATCTCTTCCCTCCGGTGAGTTGTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.02% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 98.50% 1.40% 0.07% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728437840 G -> T LOC_Os07g47540.1 upstream_gene_variant ; 251.0bp to feature; MODIFIER silent_mutation Average:47.407; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0728437840 G -> T LOC_Os07g47530.1 downstream_gene_variant ; 2514.0bp to feature; MODIFIER silent_mutation Average:47.407; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0728437840 G -> T LOC_Os07g47550.1 downstream_gene_variant ; 1893.0bp to feature; MODIFIER silent_mutation Average:47.407; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0728437840 G -> T LOC_Os07g47530.2 downstream_gene_variant ; 3555.0bp to feature; MODIFIER silent_mutation Average:47.407; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0728437840 G -> T LOC_Os07g47540-LOC_Os07g47550 intergenic_region ; MODIFIER silent_mutation Average:47.407; most accessible tissue: Minghui63 root, score: 87.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728437840 2.42E-06 NA mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 1.66E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 3.77E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 9.23E-42 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 1.96E-50 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 5.37E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 3.56E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 2.15E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 5.47E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 2.20E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 2.31E-34 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 4.97E-48 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 8.32E-21 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728437840 NA 1.30E-27 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251