\
| Variant ID: vg0728428950 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28428950 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.26, others allele: 0.00, population size: 236. )
GACATACACTATTGCTTGAATTAATATGGTTCTTGGATATATTTCATTTTTCTTTTCAGGGACAGTCTTCAAAGTCGAAGGAATCTGAGTCGTACAAAAA[A/G]
GGTAAGACTATGCATGTACTATTAGTTATATGCACAGACTCACTGAGTAGTGACTGCTTTGGTCGCTATGTATGCCTAGTTTAAGTAGAAAATCATTGAG
CTCAATGATTTTCTACTTAAACTAGGCATACATAGCGACCAAAGCAGTCACTACTCAGTGAGTCTGTGCATATAACTAATAGTACATGCATAGTCTTACC[T/C]
TTTTTGTACGACTCAGATTCCTTCGACTTTGAAGACTGTCCCTGAAAAGAAAAATGAAATATATCCAAGAACCATATTAATTCAAGCAATAGTGTATGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 42.20% | 0.11% | 0.02% | NA |
| All Indica | 2759 | 93.20% | 6.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.30% | 90.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.90% | 11.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728428950 | A -> DEL | LOC_Os07g47530.2 | N | frameshift_variant | Average:50.569; most accessible tissue: Callus, score: 73.156 | N | N | N | N |
| vg0728428950 | A -> DEL | LOC_Os07g47530.1 | N | frameshift_variant | Average:50.569; most accessible tissue: Callus, score: 73.156 | N | N | N | N |
| vg0728428950 | A -> G | LOC_Os07g47530.1 | splice_region_variant&synonymous_variant ; p.Lys429Lys; LOW | synonymous_codon | Average:50.569; most accessible tissue: Callus, score: 73.156 | N | N | N | N |
| vg0728428950 | A -> G | LOC_Os07g47530.2 | splice_region_variant&synonymous_variant ; p.Lys429Lys; LOW | synonymous_codon | Average:50.569; most accessible tissue: Callus, score: 73.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728428950 | NA | 1.24E-52 | mr1063 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 4.96E-34 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 7.62E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.57E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 8.77E-31 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 3.78E-18 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 3.06E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.45E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 3.71E-21 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.58E-56 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 7.48E-64 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.44E-44 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.16E-58 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 6.40E-22 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 6.93E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 2.27E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.27E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | 2.36E-06 | 5.31E-21 | mr1531_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.00E-33 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 3.63E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 1.47E-34 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728428950 | NA | 3.24E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |