Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728245843:

Variant ID: vg0728245843 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28245843
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAATAAAAAAAACTTAAAATTGTAGGATTGAATCACAACAACTAAGCCAACCAGAGGGGGGGGGTGAATGGTTGGTATGCCCAAAAACCAATACTTTA[C/T]
GGAAATAAAAGTTACCCTCAAATTCGACGGATTGCAGTCTGACCGAAGTAGATGCGCCGGTCTGACCGCCTGGTTGCCGTCGGTCTGACCGAGATTGTAT

Reverse complement sequence

ATACAATCTCGGTCAGACCGACGGCAACCAGGCGGTCAGACCGGCGCATCTACTTCGGTCAGACTGCAATCCGTCGAATTTGAGGGTAACTTTTATTTCC[G/A]
TAAAGTATTGGTTTTTGGGCATACCAACCATTCACCCCCCCCCTCTGGTTGGCTTAGTTGTTGTGATTCAATCCTACAATTTTAAGTTTTTTTTATTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	44.50%	0.23%	0.21%	NA
All Indica	2759	46.80%	52.50%	0.36%	0.33%	NA
All Japonica	1512	68.30%	31.70%	0.00%	0.00%	NA
Aus	269	50.60%	49.40%	0.00%	0.00%	NA
Indica I	595	58.80%	40.80%	0.34%	0.00%	NA
Indica II	465	28.00%	71.00%	0.43%	0.65%	NA
Indica III	913	54.90%	44.50%	0.22%	0.44%	NA
Indica Intermediate	786	39.60%	59.70%	0.51%	0.25%	NA
Temperate Japonica	767	96.50%	3.50%	0.00%	0.00%	NA
Tropical Japonica	504	22.80%	77.20%	0.00%	0.00%	NA
Japonica Intermediate	241	73.40%	26.60%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	72.20%	26.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728245843	C -> DEL	N	N	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47260.1	upstream_gene_variant ; 1498.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47250.1	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47270.1	downstream_gene_variant ; 4199.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47250.3	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47250.2	downstream_gene_variant ; 433.0bp to feature; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0728245843	C -> T	LOC_Os07g47250-LOC_Os07g47260	intergenic_region ; MODIFIER	silent_mutation	Average:74.517; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728245843	NA	6.87E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	7.60E-07	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	6.09E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	2.12E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	2.01E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	4.33E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	4.19E-06	4.19E-06	mr1833	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	5.66E-14	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	3.69E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	2.18E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	3.27E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	1.07E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	9.62E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	1.98E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728245843	NA	7.57E-10	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251