\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728022403:

Variant ID: vg0728022403 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28022403
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTCTTCATCCCTGGAATGAGGCCTTTGGTTGTTTTGTTAGTCTGCATGTATGCTGTAAGAACTTAGTAATACATGATCATTTACGGTAATACTCCCT[T/C]
TGTTCTATAATATAAGGGATTTTGAGTTTTTACTTACAATGTTTGACCACTCGTCTTATTCAAAAAGTTTGTACAAATATAAAAGACGAAAAGTTGTGCT

Reverse complement sequence

AGCACAACTTTTCGTCTTTTATATTTGTACAAACTTTTTGAATAAGACGAGTGGTCAAACATTGTAAGTAAAAACTCAAAATCCCTTATATTATAGAACA[A/G]
AGGGAGTATTACCGTAAATGATCATGTATTACTAAGTTCTTACAGCATACATGCAGACTAACAAAACAACCAAAGGCCTCATTCCAGGGATGAAGAATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 30.20% 0.78% 2.18% NA
All Indica  2759 44.10% 50.80% 1.34% 3.73% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 57.60% 40.70% 1.01% 0.67% NA
Indica II  465 29.70% 68.80% 0.65% 0.86% NA
Indica III  913 38.90% 49.60% 2.41% 9.09% NA
Indica Intermediate  786 48.60% 49.10% 0.76% 1.53% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728022403 T -> DEL N N silent_mutation Average:60.234; most accessible tissue: Callus, score: 82.623 N N N N
vg0728022403 T -> C LOC_Os07g46880.1 upstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:60.234; most accessible tissue: Callus, score: 82.623 N N N N
vg0728022403 T -> C LOC_Os07g46870.1 downstream_gene_variant ; 555.0bp to feature; MODIFIER silent_mutation Average:60.234; most accessible tissue: Callus, score: 82.623 N N N N
vg0728022403 T -> C LOC_Os07g46870-LOC_Os07g46880 intergenic_region ; MODIFIER silent_mutation Average:60.234; most accessible tissue: Callus, score: 82.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728022403 NA 1.68E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 7.48E-09 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 3.11E-06 3.11E-06 mr1460 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 2.80E-08 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 5.62E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 5.98E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 3.22E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 7.35E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 2.76E-07 NA mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 3.35E-08 5.51E-10 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 3.00E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403 NA 7.45E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251