Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728022403:

Variant ID: vg0728022403 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28022403
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTCTTCATCCCTGGAATGAGGCCTTTGGTTGTTTTGTTAGTCTGCATGTATGCTGTAAGAACTTAGTAATACATGATCATTTACGGTAATACTCCCT[T/C]
TGTTCTATAATATAAGGGATTTTGAGTTTTTACTTACAATGTTTGACCACTCGTCTTATTCAAAAAGTTTGTACAAATATAAAAGACGAAAAGTTGTGCT

Reverse complement sequence

AGCACAACTTTTCGTCTTTTATATTTGTACAAACTTTTTGAATAAGACGAGTGGTCAAACATTGTAAGTAAAAACTCAAAATCCCTTATATTATAGAACA[A/G]
AGGGAGTATTACCGTAAATGATCATGTATTACTAAGTTCTTACAGCATACATGCAGACTAACAAAACAACCAAAGGCCTCATTCCAGGGATGAAGAATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	30.20%	0.78%	2.18%	NA
All Indica	2759	44.10%	50.80%	1.34%	3.73%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	57.60%	40.70%	1.01%	0.67%	NA
Indica II	465	29.70%	68.80%	0.65%	0.86%	NA
Indica III	913	38.90%	49.60%	2.41%	9.09%	NA
Indica Intermediate	786	48.60%	49.10%	0.76%	1.53%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728022403	T -> DEL	N	N	silent_mutation	Average:60.234; most accessible tissue: Callus, score: 82.623	N	N	N	N
vg0728022403	T -> C	LOC_Os07g46880.1	upstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:60.234; most accessible tissue: Callus, score: 82.623	N	N	N	N
vg0728022403	T -> C	LOC_Os07g46870.1	downstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:60.234; most accessible tissue: Callus, score: 82.623	N	N	N	N
vg0728022403	T -> C	LOC_Os07g46870-LOC_Os07g46880	intergenic_region ; MODIFIER	silent_mutation	Average:60.234; most accessible tissue: Callus, score: 82.623	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728022403	NA	1.68E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	7.48E-09	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	3.11E-06	3.11E-06	mr1460	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	2.80E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	5.62E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	5.98E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	3.22E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	7.35E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	2.76E-07	NA	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	3.35E-08	5.51E-10	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	3.00E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728022403	NA	7.45E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251