\
| Variant ID: vg0728021019 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28021019 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )
TGGCCGTCATCACCGGCGGCGCCAGCGGCATCGGCAAGGCGACGGCCACGGAGTTCATCAAGAACGGCGCCAAGGTCATCATCGCCGACATCCAGGACGA[C/T]
CTCGGCCACTCGGTGGCGGCGGAGCTCGGCCCGGACGCCGCGTACACGCGCTGCGACGTCGCCGACGAGGCGCAGGTCGCCGCGGCCGTGGGCCTCGCCG
CGGCGAGGCCCACGGCCGCGGCGACCTGCGCCTCGTCGGCGACGTCGCAGCGCGTGTACGCGGCGTCCGGGCCGAGCTCCGCCGCCACCGAGTGGCCGAG[G/A]
TCGTCCTGGATGTCGGCGATGATGACCTTGGCGCCGTTCTTGATGAACTCCGTGGCCGTCGCCTTGCCGATGCCGCTGGCGCCGCCGGTGATGACGGCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.90% | 13.40% | 9.31% | 7.38% | NA |
| All Indica | 2759 | 49.30% | 22.50% | 15.66% | 12.47% | NA |
| All Japonica | 1512 | 99.40% | 0.30% | 0.13% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.00% | 12.10% | 22.02% | 7.90% | NA |
| Indica II | 465 | 30.30% | 42.20% | 18.49% | 9.03% | NA |
| Indica III | 913 | 51.70% | 20.90% | 9.20% | 18.18% | NA |
| Indica Intermediate | 786 | 51.30% | 20.70% | 16.67% | 11.32% | NA |
| Temperate Japonica | 767 | 99.10% | 0.70% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 7.80% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728021019 | C -> DEL | LOC_Os07g46870.1 | N | frameshift_variant | Average:72.373; most accessible tissue: Zhenshan97 root, score: 86.472 | N | N | N | N |
| vg0728021019 | C -> T | LOC_Os07g46870.1 | synonymous_variant ; p.Asp77Asp; LOW | synonymous_codon | Average:72.373; most accessible tissue: Zhenshan97 root, score: 86.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728021019 | NA | 3.76E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 4.28E-08 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | 1.30E-06 | 1.30E-06 | mr1460 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 8.57E-08 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 6.03E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 3.10E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 1.22E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 1.10E-06 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | 2.64E-06 | NA | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | 1.76E-07 | 4.84E-09 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728021019 | NA | 5.54E-07 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |