Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727982897:

Variant ID: vg0727982897 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27982897
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTAGGCCTCTTTCCCTCTCGACAGCGTGCTGTCGTTGTAAGCGTTTTTACGTAACAAATTCCCCCTTTCTTAATGAAATTGGTCGACCGAATCTTTCGG[C/T]
CGACCCGGCAAAAAAAAAAAAAGTGTTCAGGCAACATGGCGATCACTGCAGTTAGATTACTGTGTTGATGTTTGACTCTCAACTTTTGGTCAATGCTATA

Reverse complement sequence

TATAGCATTGACCAAAAGTTGAGAGTCAAACATCAACACAGTAATCTAACTGCAGTGATCGCCATGTTGCCTGAACACTTTTTTTTTTTTTGCCGGGTCG[G/A]
CCGAAAGATTCGGTCGACCAATTTCATTAAGAAAGGGGGAATTTGTTACGTAAAAACGCTTACAACGACAGCACGCTGTCGAGAGGGAAAGAGGCCTAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.60%	32.50%	5.01%	10.92%	NA
All Indica	2759	23.20%	53.50%	6.89%	16.42%	NA
All Japonica	1512	95.00%	2.20%	0.93%	1.85%	NA
Aus	269	91.10%	0.00%	1.86%	7.06%	NA
Indica I	595	36.00%	39.70%	9.41%	14.96%	NA
Indica II	465	20.00%	57.60%	5.59%	16.77%	NA
Indica III	913	13.50%	64.70%	5.59%	16.21%	NA
Indica Intermediate	786	26.70%	48.50%	7.25%	17.56%	NA
Temperate Japonica	767	97.90%	0.40%	0.65%	1.04%	NA
Tropical Japonica	504	90.70%	5.60%	0.79%	2.98%	NA
Japonica Intermediate	241	95.00%	0.80%	2.07%	2.07%	NA
VI/Aromatic	96	59.40%	12.50%	18.75%	9.38%	NA
Intermediate	90	64.40%	16.70%	11.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727982897	C -> DEL	N	N	silent_mutation	Average:64.219; most accessible tissue: Zhenshan97 root, score: 87.466	N	N	N	N
vg0727982897	C -> T	LOC_Os07g46810.1	3_prime_UTR_variant ; 153.0bp to feature; MODIFIER	silent_mutation	Average:64.219; most accessible tissue: Zhenshan97 root, score: 87.466	N	N	N	N
vg0727982897	C -> T	LOC_Os07g46820.1	downstream_gene_variant ; 317.0bp to feature; MODIFIER	silent_mutation	Average:64.219; most accessible tissue: Zhenshan97 root, score: 87.466	N	N	N	N
vg0727982897	C -> T	LOC_Os07g46820.3	downstream_gene_variant ; 317.0bp to feature; MODIFIER	silent_mutation	Average:64.219; most accessible tissue: Zhenshan97 root, score: 87.466	N	N	N	N
vg0727982897	C -> T	LOC_Os07g46820.2	downstream_gene_variant ; 367.0bp to feature; MODIFIER	silent_mutation	Average:64.219; most accessible tissue: Zhenshan97 root, score: 87.466	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0727982897	C	T	0.02	0.0	-0.01	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727982897	NA	1.13E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	NA	5.00E-08	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	NA	1.98E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	NA	7.03E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	1.09E-09	NA	mr1457_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	1.07E-10	5.98E-12	mr1457_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727982897	NA	6.94E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251