RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0727970899:

Variant ID: vg0727970899 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27970899
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAATAAAGAAGATGTCATAGTTAATTGCATGCTTACATGCATGCCTTATACTATAGAACATTTAAGAAAAGTGGTTGTGCCTTATATTATGGAATG[T/G]
AGGGAGTACTATGCACGAACGCCACTGGCTATGACCGATAAGAAAAACACGTGTAAAAATTTTACCAATAAATTATATTTTCTCTTATAAACAACTAAGT

Reverse complement sequence

ACTTAGTTGTTTATAAGAGAAAATATAATTTATTGGTAAAATTTTTACACGTGTTTTTCTTATCGGTCATAGCCAGTGGCGTTCGTGCATAGTACTCCCT[A/C]
CATTCCATAATATAAGGCACAACCACTTTTCTTAAATGTTCTATAGTATAAGGCATGCATGTAAGCATGCAATTAACTATGACATCTTCTTTATTAAATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	3.50%	1.33%	0.00%	NA
All Indica	2759	98.80%	0.00%	1.23%	0.00%	NA
All Japonica	1512	87.60%	10.70%	1.65%	0.00%	NA
Aus	269	97.80%	0.70%	1.49%	0.00%	NA
Indica I	595	96.10%	0.00%	3.87%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.00%	1.15%	0.00%	NA
Temperate Japonica	767	98.00%	1.20%	0.78%	0.00%	NA
Tropical Japonica	504	87.10%	12.10%	0.79%	0.00%	NA
Japonica Intermediate	241	55.60%	38.20%	6.22%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727970899	T -> G	LOC_Os07g46800.1	upstream_gene_variant ; 589.0bp to feature; MODIFIER	silent_mutation	Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0727970899	T -> G	LOC_Os07g46790.1	downstream_gene_variant ; 2882.0bp to feature; MODIFIER	silent_mutation	Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0727970899	T -> G	LOC_Os07g46800-LOC_Os07g46810	intergenic_region ; MODIFIER	silent_mutation	Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727970899	5.27E-06	2.13E-07	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	7.52E-07	5.42E-10	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	1.41E-06	7.45E-08	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	1.36E-08	3.43E-13	mr1117	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	2.11E-06	2.86E-11	mr1118	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	1.20E-07	6.97E-10	mr1119	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	5.73E-07	8.10E-09	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	3.79E-06	6.52E-10	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	NA	3.27E-08	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899	1.23E-06	4.38E-11	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 32 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0727970899:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact