\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727970899:

Variant ID: vg0727970899 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27970899
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAATAAAGAAGATGTCATAGTTAATTGCATGCTTACATGCATGCCTTATACTATAGAACATTTAAGAAAAGTGGTTGTGCCTTATATTATGGAATG[T/G]
AGGGAGTACTATGCACGAACGCCACTGGCTATGACCGATAAGAAAAACACGTGTAAAAATTTTACCAATAAATTATATTTTCTCTTATAAACAACTAAGT

Reverse complement sequence

ACTTAGTTGTTTATAAGAGAAAATATAATTTATTGGTAAAATTTTTACACGTGTTTTTCTTATCGGTCATAGCCAGTGGCGTTCGTGCATAGTACTCCCT[A/C]
CATTCCATAATATAAGGCACAACCACTTTTCTTAAATGTTCTATAGTATAAGGCATGCATGTAAGCATGCAATTAACTATGACATCTTCTTTATTAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 3.50% 1.33% 0.00% NA
All Indica  2759 98.80% 0.00% 1.23% 0.00% NA
All Japonica  1512 87.60% 10.70% 1.65% 0.00% NA
Aus  269 97.80% 0.70% 1.49% 0.00% NA
Indica I  595 96.10% 0.00% 3.87% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.00% 1.15% 0.00% NA
Temperate Japonica  767 98.00% 1.20% 0.78% 0.00% NA
Tropical Japonica  504 87.10% 12.10% 0.79% 0.00% NA
Japonica Intermediate  241 55.60% 38.20% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727970899 T -> G LOC_Os07g46800.1 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0727970899 T -> G LOC_Os07g46790.1 downstream_gene_variant ; 2882.0bp to feature; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0727970899 T -> G LOC_Os07g46800-LOC_Os07g46810 intergenic_region ; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727970899 5.27E-06 2.13E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 7.52E-07 5.42E-10 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.41E-06 7.45E-08 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.36E-08 3.43E-13 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 2.11E-06 2.86E-11 mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.20E-07 6.97E-10 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 5.73E-07 8.10E-09 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 3.79E-06 6.52E-10 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 3.27E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.23E-06 4.38E-11 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 2.00E-07 3.68E-10 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 8.38E-08 1.48E-11 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 4.33E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 6.02E-06 4.77E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 9.95E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.19E-07 1.73E-11 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.85E-09 1.19E-13 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 5.99E-11 1.09E-16 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.83E-06 4.30E-11 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 5.19E-10 3.49E-15 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 2.60E-08 2.86E-12 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 4.42E-08 3.36E-12 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 1.38E-08 8.51E-15 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 8.38E-08 6.56E-13 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 7.55E-09 5.10E-13 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 8.85E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 8.11E-10 1.42E-16 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 7.08E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 5.71E-08 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 9.14E-07 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 3.30E-06 5.42E-09 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727970899 NA 3.30E-07 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251