Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727936135:

Variant ID: vg0727936135 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27936135
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTCTGGTTCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACATTATTTTATTATTTCTAGTTCAAAAGAG[G/A]
TGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACACCAGTGGGTCCCACATGTCATAGACAGTGTATGTTTAATCTAATTTT

Reverse complement sequence

AAAATTAGATTAAACATACACTGTCTATGACATGTGGGACCCACTGGTGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCA[C/T]
CTCTTTTGAACTAGAAATAATAAAATAATGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGAACCAGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	33.60%	0.97%	0.00%	NA
All Indica	2759	45.40%	53.40%	1.20%	0.00%	NA
All Japonica	1512	97.80%	1.50%	0.73%	0.00%	NA
Aus	269	79.20%	20.80%	0.00%	0.00%	NA
Indica I	595	58.00%	41.50%	0.50%	0.00%	NA
Indica II	465	31.20%	66.90%	1.94%	0.00%	NA
Indica III	913	42.20%	57.40%	0.44%	0.00%	NA
Indica Intermediate	786	48.00%	49.90%	2.16%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	2.20%	2.18%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727936135	G -> A	LOC_Os07g46730.1	upstream_gene_variant ; 3366.0bp to feature; MODIFIER	silent_mutation	Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0727936135	G -> A	LOC_Os07g46740.1	upstream_gene_variant ; 548.0bp to feature; MODIFIER	silent_mutation	Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0727936135	G -> A	LOC_Os07g46730.2	upstream_gene_variant ; 2293.0bp to feature; MODIFIER	silent_mutation	Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0727936135	G -> A	LOC_Os07g46730-LOC_Os07g46740	intergenic_region ; MODIFIER	silent_mutation	Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727936135	NA	9.42E-09	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	1.22E-09	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	8.13E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	1.67E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	1.59E-09	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	3.54E-07	mr1502	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	NA	5.66E-07	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	4.21E-06	NA	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135	4.12E-07	5.61E-09	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251