\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727936135:

Variant ID: vg0727936135 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27936135
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTGGTTCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACATTATTTTATTATTTCTAGTTCAAAAGAG[G/A]
TGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACACCAGTGGGTCCCACATGTCATAGACAGTGTATGTTTAATCTAATTTT

Reverse complement sequence

AAAATTAGATTAAACATACACTGTCTATGACATGTGGGACCCACTGGTGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCA[C/T]
CTCTTTTGAACTAGAAATAATAAAATAATGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGAACCAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 33.60% 0.97% 0.00% NA
All Indica  2759 45.40% 53.40% 1.20% 0.00% NA
All Japonica  1512 97.80% 1.50% 0.73% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 58.00% 41.50% 0.50% 0.00% NA
Indica II  465 31.20% 66.90% 1.94% 0.00% NA
Indica III  913 42.20% 57.40% 0.44% 0.00% NA
Indica Intermediate  786 48.00% 49.90% 2.16% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 2.20% 2.18% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727936135 G -> A LOC_Os07g46730.1 upstream_gene_variant ; 3366.0bp to feature; MODIFIER silent_mutation Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0727936135 G -> A LOC_Os07g46740.1 upstream_gene_variant ; 548.0bp to feature; MODIFIER silent_mutation Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0727936135 G -> A LOC_Os07g46730.2 upstream_gene_variant ; 2293.0bp to feature; MODIFIER silent_mutation Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0727936135 G -> A LOC_Os07g46730-LOC_Os07g46740 intergenic_region ; MODIFIER silent_mutation Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727936135 NA 9.42E-09 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 1.22E-09 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 8.13E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 1.67E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 1.59E-09 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 3.54E-07 mr1502 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 NA 5.66E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 4.21E-06 NA mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727936135 4.12E-07 5.61E-09 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251