\
| Variant ID: vg0727936135 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27936135 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 209. )
ATTTCTGGTTCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACATTATTTTATTATTTCTAGTTCAAAAGAG[G/A]
TGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACACCAGTGGGTCCCACATGTCATAGACAGTGTATGTTTAATCTAATTTT
AAAATTAGATTAAACATACACTGTCTATGACATGTGGGACCCACTGGTGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCA[C/T]
CTCTTTTGAACTAGAAATAATAAAATAATGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGAACCAGAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 33.60% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 45.40% | 53.40% | 1.20% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 1.50% | 0.73% | 0.00% | NA |
| Aus | 269 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.00% | 41.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 31.20% | 66.90% | 1.94% | 0.00% | NA |
| Indica III | 913 | 42.20% | 57.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 48.00% | 49.90% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 2.20% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 20.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727936135 | G -> A | LOC_Os07g46730.1 | upstream_gene_variant ; 3366.0bp to feature; MODIFIER | silent_mutation | Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0727936135 | G -> A | LOC_Os07g46740.1 | upstream_gene_variant ; 548.0bp to feature; MODIFIER | silent_mutation | Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0727936135 | G -> A | LOC_Os07g46730.2 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0727936135 | G -> A | LOC_Os07g46730-LOC_Os07g46740 | intergenic_region ; MODIFIER | silent_mutation | Average:47.959; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727936135 | NA | 9.42E-09 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 1.22E-09 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 8.13E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 1.67E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 1.59E-09 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 3.54E-07 | mr1502 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | NA | 5.66E-07 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | 4.21E-06 | NA | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727936135 | 4.12E-07 | 5.61E-09 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |