Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727932446:

Variant ID: vg0727932446 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27932446
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAACACACCCATACATCAATTTTTGGAGATGTTCATAAGAATGAAAGCTCTTGAAATTACCAAATCTTAATACAGTATGATAGTATTGATTAAAATAC[T/G,A]
TCTGGTTTTCCTACTGAAAAAATGGCAAGAACAAAAACGGTCCTAAATAAAAACATAAATTTGAATGCCAAAATTGAAAGAAAACAAATCAAACATACTG

Reverse complement sequence

CAGTATGTTTGATTTGTTTTCTTTCAATTTTGGCATTCAAATTTATGTTTTTATTTAGGACCGTTTTTGTTCTTGCCATTTTTTCAGTAGGAAAACCAGA[A/C,T]
GTATTTTAATCAATACTATCATACTGTATTAAGATTTGGTAATTTCAAGAGCTTTCATTCTTATGAACATCTCCAAAAATTGATGTATGGGTGTGTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.10%	0.40%	0.00%	A: 0.06%
All Indica	2759	34.00%	65.30%	0.65%	0.00%	NA
All Japonica	1512	93.70%	6.20%	0.00%	0.00%	A: 0.13%
Aus	269	78.10%	21.90%	0.00%	0.00%	NA
Indica I	595	52.60%	46.60%	0.84%	0.00%	NA
Indica II	465	28.60%	70.80%	0.65%	0.00%	NA
Indica III	913	21.40%	78.10%	0.55%	0.00%	NA
Indica Intermediate	786	37.80%	61.60%	0.64%	0.00%	NA
Temperate Japonica	767	97.70%	2.10%	0.00%	0.00%	A: 0.26%
Tropical Japonica	504	87.50%	12.50%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	57.80%	40.00%	1.11%	0.00%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727932446	T -> G	LOC_Os07g46730.1	5_prime_UTR_variant ; 582.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> G	LOC_Os07g46740.1	upstream_gene_variant ; 4237.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> G	LOC_Os07g46720.1	downstream_gene_variant ; 1792.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> G	LOC_Os07g46720.2	downstream_gene_variant ; 1792.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> G	LOC_Os07g46730.2	intron_variant ; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46730.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46730.1	5_prime_UTR_variant ; 582.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46740.1	upstream_gene_variant ; 4237.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46720.1	downstream_gene_variant ; 1792.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46720.2	downstream_gene_variant ; 1792.0bp to feature; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0727932446	T -> A	LOC_Os07g46730.2	intron_variant ; MODIFIER	silent_mutation	Average:37.541; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727932446	3.50E-06	3.17E-06	mr1928	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727932446	NA	1.89E-07	mr1036_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727932446	NA	6.66E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727932446	NA	7.59E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251