| Variant ID: vg0727913447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27913447 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
CGATGGAACATCCCCATCCCATCCCTTCAAATGCATCAGATTCCAGCACTTAAAAATAAGTCAGGGACACATGTACATATATATACATCCAAATGTAGAT[A/C]
TACTAATAGATCTAACAAATCTACTTGTTTTTGTTGATAATGTTTCCACCTGACTGAAATAATAATAATTCGAAGTGCATAAAGGAAACGATTCGTTATG
CATAACGAATCGTTTCCTTTATGCACTTCGAATTATTATTATTTCAGTCAGGTGGAAACATTATCAACAAAAACAAGTAGATTTGTTAGATCTATTAGTA[T/G]
ATCTACATTTGGATGTATATATATGTACATGTGTCCCTGACTTATTTTTAAGTGCTGGAATCTGATGCATTTGAAGGGATGGGATGGGGATGTTCCATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 13.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 60.50% | 39.00% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 30.90% | 68.10% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727913447 | A -> C | LOC_Os07g46690.1 | upstream_gene_variant ; 1238.0bp to feature; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| vg0727913447 | A -> C | LOC_Os07g46700.1 | downstream_gene_variant ; 1874.0bp to feature; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| vg0727913447 | A -> C | LOC_Os07g46700.2 | downstream_gene_variant ; 2290.0bp to feature; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| vg0727913447 | A -> C | LOC_Os07g46700.3 | downstream_gene_variant ; 2290.0bp to feature; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| vg0727913447 | A -> C | LOC_Os07g46700.4 | downstream_gene_variant ; 2290.0bp to feature; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| vg0727913447 | A -> C | LOC_Os07g46690-LOC_Os07g46700 | intergenic_region ; MODIFIER | silent_mutation | Average:44.995; most accessible tissue: Callus, score: 83.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727913447 | NA | 4.27E-29 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 1.01E-11 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 8.76E-10 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | 3.56E-08 | 2.15E-42 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 9.82E-17 | mr1137_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 7.87E-07 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 1.59E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 1.96E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | 1.97E-06 | 6.97E-29 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 1.79E-11 | mr1617_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727913447 | NA | 2.76E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |