\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727849372:

Variant ID: vg0727849372 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27849372
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCACGGTTACGGGATAACCGTCTTACCATGTGGTGACGGTAACTCGACTAAAAGCGATTTGGTGAATCTTGACCCTCATCTTTGGTGGAACAGTCAC[A/G]
TCATCTCACAGGTGAATCCATTTATTGATAGTGTGGTTTATGAAACGACACTGCCAAAATATATGTAGTTAAATGCCAAGTGTCAAAATATGCGTGACTT

Reverse complement sequence

AAGTCACGCATATTTTGACACTTGGCATTTAACTACATATATTTTGGCAGTGTCGTTTCATAAACCACACTATCAATAAATGGATTCACCTGTGAGATGA[T/C]
GTGACTGTTCCACCAAAGATGAGGGTCAAGATTCACCAAATCGCTTTTAGTCGAGTTACCGTCACCACATGGTAAGACGGTTATCCCGTAACCGTGCGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.90% 0.04% 0.00% NA
All Indica  2759 81.10% 18.80% 0.04% 0.00% NA
All Japonica  1512 53.00% 47.00% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 66.70% 33.30% 0.00% 0.00% NA
Indica Intermediate  786 80.70% 19.30% 0.00% 0.00% NA
Temperate Japonica  767 21.40% 78.60% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 8.90% 0.20% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727849372 A -> G LOC_Os07g46600.1 upstream_gene_variant ; 3938.0bp to feature; MODIFIER silent_mutation Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0727849372 A -> G LOC_Os07g46610.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0727849372 A -> G LOC_Os07g46620.1 upstream_gene_variant ; 1425.0bp to feature; MODIFIER silent_mutation Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0727849372 A -> G LOC_Os07g46610-LOC_Os07g46620 intergenic_region ; MODIFIER silent_mutation Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727849372 NA 1.22E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 5.09E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 5.24E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 1.09E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 4.37E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 9.34E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 NA 2.46E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372 7.27E-07 2.69E-07 mr1165_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251