Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727849372:

Variant ID: vg0727849372 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27849372
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGCACGGTTACGGGATAACCGTCTTACCATGTGGTGACGGTAACTCGACTAAAAGCGATTTGGTGAATCTTGACCCTCATCTTTGGTGGAACAGTCAC[A/G]
TCATCTCACAGGTGAATCCATTTATTGATAGTGTGGTTTATGAAACGACACTGCCAAAATATATGTAGTTAAATGCCAAGTGTCAAAATATGCGTGACTT

Reverse complement sequence

AAGTCACGCATATTTTGACACTTGGCATTTAACTACATATATTTTGGCAGTGTCGTTTCATAAACCACACTATCAATAAATGGATTCACCTGTGAGATGA[T/C]
GTGACTGTTCCACCAAAGATGAGGGTCAAGATTCACCAAATCGCTTTTAGTCGAGTTACCGTCACCACATGGTAAGACGGTTATCCCGTAACCGTGCGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.90%	0.04%	0.00%	NA
All Indica	2759	81.10%	18.80%	0.04%	0.00%	NA
All Japonica	1512	53.00%	47.00%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	66.70%	33.30%	0.00%	0.00%	NA
Indica Intermediate	786	80.70%	19.30%	0.00%	0.00%	NA
Temperate Japonica	767	21.40%	78.60%	0.00%	0.00%	NA
Tropical Japonica	504	90.90%	8.90%	0.20%	0.00%	NA
Japonica Intermediate	241	74.30%	25.70%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727849372	A -> G	LOC_Os07g46600.1	upstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:57.066; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0727849372	A -> G	LOC_Os07g46610.1	upstream_gene_variant ; 1578.0bp to feature; MODIFIER	silent_mutation	Average:57.066; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0727849372	A -> G	LOC_Os07g46620.1	upstream_gene_variant ; 1425.0bp to feature; MODIFIER	silent_mutation	Average:57.066; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0727849372	A -> G	LOC_Os07g46610-LOC_Os07g46620	intergenic_region ; MODIFIER	silent_mutation	Average:57.066; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727849372	NA	1.22E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	5.09E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	5.24E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	1.09E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	4.37E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	9.34E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	NA	2.46E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849372	7.27E-07	2.69E-07	mr1165_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251