\
| Variant ID: vg0727849372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27849372 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 204. )
ACCGCACGGTTACGGGATAACCGTCTTACCATGTGGTGACGGTAACTCGACTAAAAGCGATTTGGTGAATCTTGACCCTCATCTTTGGTGGAACAGTCAC[A/G]
TCATCTCACAGGTGAATCCATTTATTGATAGTGTGGTTTATGAAACGACACTGCCAAAATATATGTAGTTAAATGCCAAGTGTCAAAATATGCGTGACTT
AAGTCACGCATATTTTGACACTTGGCATTTAACTACATATATTTTGGCAGTGTCGTTTCATAAACCACACTATCAATAAATGGATTCACCTGTGAGATGA[T/C]
GTGACTGTTCCACCAAAGATGAGGGTCAAGATTCACCAAATCGCTTTTAGTCGAGTTACCGTCACCACATGGTAAGACGGTTATCCCGTAACCGTGCGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 26.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 81.10% | 18.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 53.00% | 47.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 21.40% | 78.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 8.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727849372 | A -> G | LOC_Os07g46600.1 | upstream_gene_variant ; 3938.0bp to feature; MODIFIER | silent_mutation | Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0727849372 | A -> G | LOC_Os07g46610.1 | upstream_gene_variant ; 1578.0bp to feature; MODIFIER | silent_mutation | Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0727849372 | A -> G | LOC_Os07g46620.1 | upstream_gene_variant ; 1425.0bp to feature; MODIFIER | silent_mutation | Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0727849372 | A -> G | LOC_Os07g46610-LOC_Os07g46620 | intergenic_region ; MODIFIER | silent_mutation | Average:57.066; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727849372 | NA | 1.22E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 5.09E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 5.24E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 1.09E-07 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 4.37E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 9.34E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | NA | 2.46E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727849372 | 7.27E-07 | 2.69E-07 | mr1165_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |