\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727849191:

Variant ID: vg0727849191 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27849191
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, T: 0.18, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAACATGCATCGTACTGGAATATGTGTGTCCAGCTTATATAGCACTTGAGGCCACTCACAATATGAGTTGCTTGCCTTGATAATGCCCTCACCAGGGTTT[A/T]
CAGAACCACTGTTATAACACGTGGCAACCTTCTTAGGTTTGAAACCACGGTAATTCTCGTGATAACCGTATGTCATGGTAACCGCACGGTTACGGGATAA

Reverse complement sequence

TTATCCCGTAACCGTGCGGTTACCATGACATACGGTTATCACGAGAATTACCGTGGTTTCAAACCTAAGAAGGTTGCCACGTGTTATAACAGTGGTTCTG[T/A]
AAACCCTGGTGAGGGCATTATCAAGGCAAGCAACTCATATTGTGAGTGGCCTCAAGTGCTATATAAGCTGGACACACATATTCCAGTACGATGCATGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.90% 0.04% 0.00% NA
All Indica  2759 81.10% 18.80% 0.07% 0.00% NA
All Japonica  1512 53.10% 46.90% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 91.80% 8.00% 0.22% 0.00% NA
Indica III  913 66.60% 33.40% 0.00% 0.00% NA
Indica Intermediate  786 80.50% 19.30% 0.13% 0.00% NA
Temperate Japonica  767 21.40% 78.60% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 8.90% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727849191 A -> T LOC_Os07g46600.1 upstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Callus, score: 92.723 N N N N
vg0727849191 A -> T LOC_Os07g46610.1 upstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Callus, score: 92.723 N N N N
vg0727849191 A -> T LOC_Os07g46620.1 upstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:67.629; most accessible tissue: Callus, score: 92.723 N N N N
vg0727849191 A -> T LOC_Os07g46610-LOC_Os07g46620 intergenic_region ; MODIFIER silent_mutation Average:67.629; most accessible tissue: Callus, score: 92.723 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727849191 NA 2.16E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 8.91E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 1.83E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 3.39E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 3.08E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 6.89E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 1.08E-06 3.39E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727849191 NA 6.82E-06 mr1522_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251