\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727650534:

Variant ID: vg0727650534 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27650534
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATGCCAAGGGAAGGAGAAAAAACAAAAACAAAAACCGCGGAAAAGGAAGAGACTACGCAACTCCAATTAGCAGGAAGGGGGCAACCACACTACCCTC[C/T]
CAAGAAAACCCCAAAAGTAGCAATGCCAGCTAACGACCATATATGACTCTTGAGATGGACTCTAGAATCACTGAGACCGAAAAGAGTGCAGAGTCAAAAA

Reverse complement sequence

TTTTTGACTCTGCACTCTTTTCGGTCTCAGTGATTCTAGAGTCCATCTCAAGAGTCATATATGGTCGTTAGCTGGCATTGCTACTTTTGGGGTTTTCTTG[G/A]
GAGGGTAGTGTGGTTGCCCCCTTCCTGCTAATTGGAGTTGCGTAGTCTCTTCCTTTTCCGCGGTTTTTGTTTTTGTTTTTTCTCCTTCCCTTGGCATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.20% 0.15% 0.00% NA
All Indica  2759 74.60% 25.30% 0.18% 0.00% NA
All Japonica  1512 50.70% 49.20% 0.13% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 47.60% 52.10% 0.22% 0.00% NA
Indica Intermediate  786 78.40% 21.20% 0.38% 0.00% NA
Temperate Japonica  767 86.20% 13.60% 0.26% 0.00% NA
Tropical Japonica  504 6.70% 93.30% 0.00% 0.00% NA
Japonica Intermediate  241 29.50% 70.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727650534 C -> T LOC_Os07g46360.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:58.671; most accessible tissue: Callus, score: 71.457 N N N N
vg0727650534 C -> T LOC_Os07g46350-LOC_Os07g46360 intergenic_region ; MODIFIER silent_mutation Average:58.671; most accessible tissue: Callus, score: 71.457 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727650534 NA 9.56E-06 mr1187 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 8.50E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 3.80E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 2.52E-07 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 5.51E-06 4.96E-07 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 7.99E-06 NA mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.63E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 4.83E-06 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.72E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 5.74E-06 NA mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 7.76E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 5.45E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.47E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 9.98E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 9.77E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 7.12E-06 7.12E-06 mr1581_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 2.07E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 7.34E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 2.54E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 2.41E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 5.56E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.66E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727650534 NA 1.76E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251