\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727649748:

Variant ID: vg0727649748 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27649748
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, T: 0.30, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGTTAGAAGAGGTTACATTTTGTATCTTGTATGCATTAATCATTGGGTAGTAGAATAGTTAAGGTTTATCCCTCCATTCCCAATTTATTTAAAAAAA[T/G]
ACACGAATATTAGGAAAGAATCTAATATCAGATAATTAGAAGGGGTGAGGCTTCAAACTCAGGTTGTCATATCAAATAATTAGAAGGGGTGGGGCTTCGA

Reverse complement sequence

TCGAAGCCCCACCCCTTCTAATTATTTGATATGACAACCTGAGTTTGAAGCCTCACCCCTTCTAATTATCTGATATTAGATTCTTTCCTAATATTCGTGT[A/C]
TTTTTTTAAATAAATTGGGAATGGAGGGATAAACCTTAACTATTCTACTACCCAATGATTAATGCATACAAGATACAAAATGTAACCTCTTCTAACTCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.60% 0.11% 0.00% NA
All Indica  2759 95.10% 4.80% 0.04% 0.00% NA
All Japonica  1512 50.40% 49.30% 0.26% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.30% 0.13% 0.00% NA
Temperate Japonica  767 14.90% 84.60% 0.52% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727649748 T -> G LOC_Os07g46360.1 downstream_gene_variant ; 3196.0bp to feature; MODIFIER silent_mutation Average:68.792; most accessible tissue: Zhenshan97 flower, score: 92.719 N N N N
vg0727649748 T -> G LOC_Os07g46350-LOC_Os07g46360 intergenic_region ; MODIFIER silent_mutation Average:68.792; most accessible tissue: Zhenshan97 flower, score: 92.719 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727649748 T G 0.0 0.0 -0.01 0.0 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727649748 NA 4.23E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727649748 NA 4.00E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 7.72E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 7.20E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 4.09E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 3.57E-06 4.51E-07 mr1174_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 3.42E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 1.33E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 2.09E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 1.04E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 1.18E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 8.72E-06 8.71E-06 mr1581_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 4.43E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 1.73E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 4.62E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727649748 NA 1.01E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251