\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727645219:

Variant ID: vg0727645219 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27645219
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAGATCAATCGTGTAAAATTGATGTTACTAGATTTATTATTAAACAAACTATCATAATATGCAACTCTTTTTTATTTTAAATATCTTACTTTTAT[A/C]
GATATTGTTGGTCAAAATAGCATCTTAGAGACAGTGTCAAAGTCCAAAATACTTATATTTTGGGACGGATGGAGCAATAGATTCGTCACTTCCCTCTGTT

Reverse complement sequence

AACAGAGGGAAGTGACGAATCTATTGCTCCATCCGTCCCAAAATATAAGTATTTTGGACTTTGACACTGTCTCTAAGATGCTATTTTGACCAACAATATC[T/G]
ATAAAAGTAAGATATTTAAAATAAAAAAGAGTTGCATATTATGATAGTTTGTTTAATAATAAATCTAGTAACATCAATTTTACACGATTGATCTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.10% 0.38% 0.00% NA
All Indica  2759 99.20% 0.70% 0.11% 0.00% NA
All Japonica  1512 57.50% 41.50% 0.99% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.70% 0.38% 0.00% NA
Temperate Japonica  767 90.90% 8.10% 1.04% 0.00% NA
Tropical Japonica  504 18.70% 80.60% 0.79% 0.00% NA
Japonica Intermediate  241 32.80% 66.00% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727645219 A -> C LOC_Os07g46350.1 upstream_gene_variant ; 1422.0bp to feature; MODIFIER silent_mutation Average:48.246; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0727645219 A -> C LOC_Os07g46350-LOC_Os07g46360 intergenic_region ; MODIFIER silent_mutation Average:48.246; most accessible tissue: Minghui63 root, score: 63.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727645219 1.37E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 5.22E-08 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 3.57E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 1.17E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 1.05E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 1.59E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 1.20E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 4.29E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727645219 NA 2.05E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251