\
| Variant ID: vg0727645219 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27645219 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAAAAAGATCAATCGTGTAAAATTGATGTTACTAGATTTATTATTAAACAAACTATCATAATATGCAACTCTTTTTTATTTTAAATATCTTACTTTTAT[A/C]
GATATTGTTGGTCAAAATAGCATCTTAGAGACAGTGTCAAAGTCCAAAATACTTATATTTTGGGACGGATGGAGCAATAGATTCGTCACTTCCCTCTGTT
AACAGAGGGAAGTGACGAATCTATTGCTCCATCCGTCCCAAAATATAAGTATTTTGGACTTTGACACTGTCTCTAAGATGCTATTTTGACCAACAATATC[T/G]
ATAAAAGTAAGATATTTAAAATAAAAAAGAGTTGCATATTATGATAGTTTGTTTAATAATAAATCTAGTAACATCAATTTTACACGATTGATCTTTTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.10% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 57.50% | 41.50% | 0.99% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 8.10% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 18.70% | 80.60% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.80% | 66.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727645219 | A -> C | LOC_Os07g46350.1 | upstream_gene_variant ; 1422.0bp to feature; MODIFIER | silent_mutation | Average:48.246; most accessible tissue: Minghui63 root, score: 63.193 | N | N | N | N |
| vg0727645219 | A -> C | LOC_Os07g46350-LOC_Os07g46360 | intergenic_region ; MODIFIER | silent_mutation | Average:48.246; most accessible tissue: Minghui63 root, score: 63.193 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727645219 | 1.37E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | 5.22E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 3.57E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 1.17E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 1.05E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 1.59E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 1.20E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 4.29E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727645219 | NA | 2.05E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |