\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727630420:

Variant ID: vg0727630420 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27630420
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.20, C: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGATACAATAGTACTGCTTGAGGAGCTTAAAATTCTGAGAATCTGCTGTTTGGTAGCCAGCTTTTATAAATCTGGAGAAGCTGGGTTTTTCAGCATCT[G/A]
GATTCAGTTCATTTTCTGAATTCTACAAGTACAGATTCTTAGAATCTAGGTAACAAACTACACTGTTTGGAGAAGCGGAGATTCTAGAAGAAGCTACAGC

Reverse complement sequence

GCTGTAGCTTCTTCTAGAATCTCCGCTTCTCCAAACAGTGTAGTTTGTTACCTAGATTCTAAGAATCTGTACTTGTAGAATTCAGAAAATGAACTGAATC[C/T]
AGATGCTGAAAAACCCAGCTTCTCCAGATTTATAAAAGCTGGCTACCAAACAGCAGATTCTCAGAATTTTAAGCTCCTCAAGCAGTACTATTGTATCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.80% 22.90% 2.01% 48.37% NA
All Indica  2759 23.60% 4.40% 1.12% 70.90% NA
All Japonica  1512 37.40% 55.60% 2.65% 4.43% NA
Aus  269 5.90% 36.40% 7.06% 50.56% NA
Indica I  595 44.20% 1.30% 0.00% 54.45% NA
Indica II  465 9.50% 1.50% 2.37% 86.67% NA
Indica III  913 14.50% 1.40% 1.31% 82.80% NA
Indica Intermediate  786 26.80% 12.00% 1.02% 60.18% NA
Temperate Japonica  767 61.30% 33.50% 5.08% 0.13% NA
Tropical Japonica  504 5.80% 82.30% 0.00% 11.90% NA
Japonica Intermediate  241 27.40% 69.70% 0.41% 2.49% NA
VI/Aromatic  96 2.10% 2.10% 2.08% 93.75% NA
Intermediate  90 35.60% 20.00% 3.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727630420 G -> DEL N N silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N
vg0727630420 G -> A LOC_Os07g46310.1 upstream_gene_variant ; 3681.0bp to feature; MODIFIER silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N
vg0727630420 G -> A LOC_Os07g46330.1 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N
vg0727630420 G -> A LOC_Os07g46315.1 downstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N
vg0727630420 G -> A LOC_Os07g46320.1 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N
vg0727630420 G -> A LOC_Os07g46320-LOC_Os07g46330 intergenic_region ; MODIFIER silent_mutation Average:89.484; most accessible tissue: Zhenshan97 young leaf, score: 98.304 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727630420 G A -0.01 -0.04 -0.03 0.0 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727630420 NA 9.66E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 2.20E-08 mr1066 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.09E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.57E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.05E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.83E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.17E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 2.50E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.51E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 5.28E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.29E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 2.20E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 7.66E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 5.11E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.39E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 8.45E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.05E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 2.75E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 5.48E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727630420 NA 1.54E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251