\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727628077:

Variant ID: vg0727628077 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27628077
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAAGAAATTGCGTTAAAATATCTCAAAATCAAGGTCAACATTAAGCTTGAAAATTTAAAATTTGATTTTTTTCTTTTACTGATTAGGCCATCTGAT[A/G]
CGAGCCAGAGACCGGTTGCCCCCTACAATACTCACTGTATACGTCCATGTCAGCGGGATCGTGACTCGCGCGTCCTCGCGTGCGCAGGCCCGCGGGCCTG

Reverse complement sequence

CAGGCCCGCGGGCCTGCGCACGCGAGGACGCGCGAGTCACGATCCCGCTGACATGGACGTATACAGTGAGTATTGTAGGGGGCAACCGGTCTCTGGCTCG[T/C]
ATCAGATGGCCTAATCAGTAAAAGAAAAAAATCAAATTTTAAATTTTCAAGCTTAATGTTGACCTTGATTTTGAGATATTTTAACGCAATTTCTTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 34.80% 0.91% 0.00% NA
All Indica  2759 91.60% 7.90% 0.51% 0.00% NA
All Japonica  1512 12.10% 86.20% 1.72% 0.00% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 94.80% 4.20% 1.01% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 79.30% 19.80% 0.89% 0.00% NA
Temperate Japonica  767 12.40% 84.40% 3.26% 0.00% NA
Tropical Japonica  504 14.10% 85.90% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.50% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727628077 A -> G LOC_Os07g46310.1 upstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N
vg0727628077 A -> G LOC_Os07g46320.1 upstream_gene_variant ; 250.0bp to feature; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N
vg0727628077 A -> G LOC_Os07g46330.1 upstream_gene_variant ; 2569.0bp to feature; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N
vg0727628077 A -> G LOC_Os07g46300.1 downstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N
vg0727628077 A -> G LOC_Os07g46315.1 downstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N
vg0727628077 A -> G LOC_Os07g46315-LOC_Os07g46320 intergenic_region ; MODIFIER silent_mutation Average:94.756; most accessible tissue: Zhenshan97 flower, score: 98.204 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727628077 A G -0.01 0.01 0.03 -0.02 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727628077 NA 9.64E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727628077 NA 4.17E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727628077 NA 3.12E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727628077 NA 4.29E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727628077 NA 1.15E-09 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727628077 NA 2.40E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727628077 5.94E-07 1.99E-13 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251