\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727596843:

Variant ID: vg0727596843 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27596843
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, G: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAGCTAAGAAAACTGGCTTTTTTAAATTATCAGAAGCTGGCTACCAAGAAGCTGTTTGAATCTTAAGCTCTCAAAATTTTGCTTCGTGTAGGAAAAGA[G/T]
CGCTTGGCTGTTGGCTCTCGCAAGTTTCTGCAGCAGATGTGAATTGTCGCTTTCTGCCAAGGCCAACAGAGAATCACAGAGATTATTATCTAAAGAAACA

Reverse complement sequence

TGTTTCTTTAGATAATAATCTCTGTGATTCTCTGTTGGCCTTGGCAGAAAGCGACAATTCACATCTGCTGCAGAAACTTGCGAGAGCCAACAGCCAAGCG[C/A]
TCTTTTCCTACACGAAGCAAAATTTTGAGAGCTTAAGATTCAAACAGCTTCTTGGTAGCCAGCTTCTGATAATTTAAAAAAGCCAGTTTTCTTAGCTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 48.80% 0.44% 0.00% NA
All Indica  2759 48.70% 50.70% 0.62% 0.00% NA
All Japonica  1512 56.50% 43.30% 0.13% 0.00% NA
Aus  269 32.00% 68.00% 0.00% 0.00% NA
Indica I  595 57.00% 42.40% 0.67% 0.00% NA
Indica II  465 15.90% 83.40% 0.65% 0.00% NA
Indica III  913 59.70% 39.80% 0.55% 0.00% NA
Indica Intermediate  786 49.00% 50.40% 0.64% 0.00% NA
Temperate Japonica  767 33.00% 66.90% 0.13% 0.00% NA
Tropical Japonica  504 85.90% 14.10% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.50% 0.41% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727596843 G -> T LOC_Os07g46240.1 upstream_gene_variant ; 2651.0bp to feature; MODIFIER silent_mutation Average:88.424; most accessible tissue: Minghui63 flower, score: 95.855 N N N N
vg0727596843 G -> T LOC_Os07g46250.1 upstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:88.424; most accessible tissue: Minghui63 flower, score: 95.855 N N N N
vg0727596843 G -> T LOC_Os07g46260.1 downstream_gene_variant ; 4828.0bp to feature; MODIFIER silent_mutation Average:88.424; most accessible tissue: Minghui63 flower, score: 95.855 N N N N
vg0727596843 G -> T LOC_Os07g46240-LOC_Os07g46250 intergenic_region ; MODIFIER silent_mutation Average:88.424; most accessible tissue: Minghui63 flower, score: 95.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727596843 G T 0.01 0.03 0.06 -0.05 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727596843 NA 7.27E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727596843 1.02E-07 2.32E-13 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 3.56E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.23E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 2.92E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.77E-06 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 8.54E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 5.00E-08 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.68E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 5.00E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.09E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 8.01E-06 mr1734 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 9.32E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 5.37E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 3.93E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 4.61E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.57E-12 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 3.23E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 4.25E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 8.81E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727596843 NA 1.12E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251