\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727594847:

Variant ID: vg0727594847 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27594847
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, A: 0.42, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGCAAATACGCACTGTTTAGTACTTTAGAAAGCGTGCGCGTGGAAAACGAGAGAGGTGAGTTGGGAAAGATAGGGGAAGAAAACAACCTAAGTAAC[A/C]
TAACCATTTAAGCTAGGCTCATCTCACTTTTTTTTTCACTCCGGCATTGGCATTTTTCTAAGACGTTGGGTAGACATCACAAGTTTTTTAAGGAAAAAGG

Reverse complement sequence

CCTTTTTCCTTAAAAAACTTGTGATGTCTACCCAACGTCTTAGAAAAATGCCAATGCCGGAGTGAAAAAAAAAGTGAGATGAGCCTAGCTTAAATGGTTA[T/G]
GTTACTTAGGTTGTTTTCTTCCCCTATCTTTCCCAACTCACCTCTCTCGTTTTCCACGCGCACGCTTTCTAAAGTACTAAACAGTGCGTATTTGCAATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 46.20% 0.04% 0.00% NA
All Indica  2759 74.70% 25.30% 0.00% 0.00% NA
All Japonica  1512 5.00% 95.00% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 40.70% 59.30% 0.00% 0.00% NA
Indica II  465 89.00% 11.00% 0.00% 0.00% NA
Indica III  913 95.00% 5.00% 0.00% 0.00% NA
Indica Intermediate  786 68.30% 31.70% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.30% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727594847 A -> C LOC_Os07g46240.1 upstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:73.581; most accessible tissue: Minghui63 flower, score: 93.772 N N N N
vg0727594847 A -> C LOC_Os07g46250.1 upstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:73.581; most accessible tissue: Minghui63 flower, score: 93.772 N N N N
vg0727594847 A -> C LOC_Os07g46240-LOC_Os07g46250 intergenic_region ; MODIFIER silent_mutation Average:73.581; most accessible tissue: Minghui63 flower, score: 93.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727594847 A C 0.02 0.02 0.01 0.02 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727594847 NA 3.26E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 5.41E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 1.47E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 3.04E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 6.63E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 2.67E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 1.44E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 1.78E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 2.04E-27 mr1715_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 8.66E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 3.17E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 7.24E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727594847 NA 9.66E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251