\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727589348:

Variant ID: vg0727589348 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27589348
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCTGGACAGATGTGTCACATGCACCCATTATCTATTATATTATGGGACGGAGGGAGTAAGGCCTGGTTTAGTTCATAAATTTTTTTTTCTCAAAAAC[G/A]
TCACATCAAATCTTTAAACACATGTATGGAGCATTAAATACAGATAAAAACAAAAACTATTTGCACAATTTGCATGGAATCCGCGAGACGAATCTTTTAA

Reverse complement sequence

TTAAAAGATTCGTCTCGCGGATTCCATGCAAATTGTGCAAATAGTTTTTGTTTTTATCTGTATTTAATGCTCCATACATGTGTTTAAAGATTTGATGTGA[C/T]
GTTTTTGAGAAAAAAAAATTTATGAACTAAACCAGGCCTTACTCCCTCCGTCCCATAATATAATAGATAATGGGTGCATGTGACACATCTGTCCAGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 21.20% 0.06% 0.00% NA
All Indica  2759 93.00% 7.00% 0.00% 0.00% NA
All Japonica  1512 47.50% 52.40% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 81.30% 18.70% 0.00% 0.00% NA
Temperate Japonica  767 67.50% 32.50% 0.00% 0.00% NA
Tropical Japonica  504 23.80% 76.00% 0.20% 0.00% NA
Japonica Intermediate  241 33.20% 66.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727589348 G -> A LOC_Os07g46230.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:76.328; most accessible tissue: Minghui63 flag leaf, score: 95.423 N N N N
vg0727589348 G -> A LOC_Os07g46240.1 downstream_gene_variant ; 1093.0bp to feature; MODIFIER silent_mutation Average:76.328; most accessible tissue: Minghui63 flag leaf, score: 95.423 N N N N
vg0727589348 G -> A LOC_Os07g46230-LOC_Os07g46240 intergenic_region ; MODIFIER silent_mutation Average:76.328; most accessible tissue: Minghui63 flag leaf, score: 95.423 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727589348 G A -0.05 -0.05 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727589348 NA 9.37E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 2.26E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 1.22E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 1.60E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 3.01E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 2.15E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 7.15E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 3.21E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 1.93E-06 1.93E-06 mr1369_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 4.38E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 3.56E-06 3.56E-06 mr1453_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 2.25E-07 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 1.75E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727589348 NA 8.42E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251