\
| Variant ID: vg0727553260 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27553260 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.03, others allele: 0.00, population size: 250. )
TCCATATTTGTGCACTTTTAGATGATCCTAGTTTTCAAGTATATAGAACTGAGCGAGTACTGTAAGATTTGTAGATTCATCTTCTTCGGGGCCCTTGTTA[A/T]
GACTATACCTAAGTAATTGAGCTCCCTCAACTCACTCTAACATTGTGCTTTCAGGTTATTATCAGCATAGTTGGTCTTCTTTTATTTGGGAAATTATTAG
CTAATAATTTCCCAAATAAAAGAAGACCAACTATGCTGATAATAACCTGAAAGCACAATGTTAGAGTGAGTTGAGGGAGCTCAATTACTTAGGTATAGTC[T/A]
TAACAAGGGCCCCGAAGAAGATGAATCTACAAATCTTACAGTACTCGCTCAGTTCTATATACTTGAAAACTAGGATCATCTAAAAGTGCACAAATATGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 58.50% | 41.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 34.80% | 65.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727553260 | A -> T | LOC_Os07g46180.1 | upstream_gene_variant ; 2613.0bp to feature; MODIFIER | silent_mutation | Average:52.329; most accessible tissue: Callus, score: 71.282 | N | N | N | N |
| vg0727553260 | A -> T | LOC_Os07g46160.1 | downstream_gene_variant ; 2697.0bp to feature; MODIFIER | silent_mutation | Average:52.329; most accessible tissue: Callus, score: 71.282 | N | N | N | N |
| vg0727553260 | A -> T | LOC_Os07g46170.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.329; most accessible tissue: Callus, score: 71.282 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727553260 | 3.36E-07 | 5.61E-12 | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | NA | 2.31E-13 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | 8.90E-07 | 5.10E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | NA | 2.67E-14 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | NA | 1.42E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | NA | 5.77E-07 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727553260 | NA | 1.66E-08 | mr1454_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |