Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727550685:

Variant ID: vg0727550685 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27550685
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCAAGCAGAAATACATCACATGGCTGGGGGCATGGGGCTCCATCCTTGTGCCCTTTTTTCACATATACCACTATGGAATTAAACCCTATCATGTGACA[C/G]
ATTTGTTATGAAACTCCAAGTTGATACTAGAATGTAGACTACAGTACATAATTCAGAATCACATGTGAAAGAAGGCTGGGGAATCAGACGCATTAGGAAT

Reverse complement sequence

ATTCCTAATGCGTCTGATTCCCCAGCCTTCTTTCACATGTGATTCTGAATTATGTACTGTAGTCTACATTCTAGTATCAACTTGGAGTTTCATAACAAAT[G/C]
TGTCACATGATAGGGTTTAATTCCATAGTGGTATATGTGAAAAAAGGGCACAAGGATGGAGCCCCATGCCCCCAGCCATGTGATGTATTTCTGCTTGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.80% 0.42% 0.30% NA
All Indica  2759 48.90% 50.20% 0.47% 0.47% NA
All Japonica  1512 57.20% 42.60% 0.20% 0.00% NA
Aus  269 82.90% 16.40% 0.74% 0.00% NA
Indica I  595 57.80% 41.00% 1.01% 0.17% NA
Indica II  465 14.80% 84.30% 0.22% 0.65% NA
Indica III  913 57.80% 41.50% 0.00% 0.66% NA
Indica Intermediate  786 51.90% 46.90% 0.76% 0.38% NA
Temperate Japonica  767 33.50% 66.50% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.30% 0.40% 0.00% NA
Japonica Intermediate  241 69.70% 29.90% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 52.20% 44.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727550685 C -> DEL N N silent_mutation Average:92.505; most accessible tissue: Zhenshan97 flower, score: 95.779 N N N N
vg0727550685 C -> G LOC_Os07g46170.1 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:92.505; most accessible tissue: Zhenshan97 flower, score: 95.779 N N N N
vg0727550685 C -> G LOC_Os07g46160.1 downstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:92.505; most accessible tissue: Zhenshan97 flower, score: 95.779 N N N N
vg0727550685 C -> G LOC_Os07g46160-LOC_Os07g46170 intergenic_region ; MODIFIER silent_mutation Average:92.505; most accessible tissue: Zhenshan97 flower, score: 95.779 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727550685 C G 0.04 0.04 0.06 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727550685 NA 1.90E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727550685 4.67E-07 4.75E-14 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 1.70E-12 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 2.47E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 5.23E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 7.10E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 5.43E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 1.02E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 4.43E-10 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 2.39E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 8.28E-14 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 8.16E-07 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 9.57E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 7.73E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 1.47E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 2.43E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 1.13E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727550685 NA 3.83E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251