\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727546013:

Variant ID: vg0727546013 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27546013
Reference Allele: GAlternative Allele: T,C
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCGACGTCCGCGCGCTCTTCGAGCTCACGCTCGTCGACCAGAGCGGCAAGGGGCAGGACAAGGTGCACACCCACTTTGGGAGGTCGCTCGAGGGCGG[G/T,C]
CCATATACCCTCAAGTACCGGGGGAGCATGTGGTGAGTAGTCAGTCCCCTTTGGCTATGCGCCCTGACATTTTGATCAGGTTGCATGCGTAGATTGTGCT

Reverse complement sequence

AGCACAATCTACGCATGCAACCTGATCAAAATGTCAGGGCGCATAGCCAAAGGGGACTGACTACTCACCACATGCTCCCCCGGTACTTGAGGGTATATGG[C/A,G]
CCGCCCTCGAGCGACCTCCCAAAGTGGGTGTGCACCTTGTCCTGCCCCTTGCCGCTCTGGTCGACGAGCGTGAGCTCGAAGAGCGCGCGGACGTCGGTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.10% 23.80% 0.04% 0.00% NA
All Indica  2759 92.40% 7.60% 0.00% 0.00% NA
All Japonica  1512 46.90% 53.10% 0.00% 0.00% NA
Aus  269 62.50% 37.50% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 79.80% 20.20% 0.00% 0.00% NA
Temperate Japonica  767 67.00% 33.00% 0.00% 0.00% NA
Tropical Japonica  504 22.40% 77.60% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727546013 G -> C LOC_Os07g46160.1 synonymous_variant ; p.Gly157Gly; LOW N Average:88.291; most accessible tissue: Zhenshan97 flag leaf, score: 93.314 N N N N
vg0727546013 G -> C LOC_Os07g46150.1 upstream_gene_variant ; 2131.0bp to feature; MODIFIER N Average:88.291; most accessible tissue: Zhenshan97 flag leaf, score: 93.314 N N N N
vg0727546013 G -> C LOC_Os07g46170.1 upstream_gene_variant ; 4819.0bp to feature; MODIFIER N Average:88.291; most accessible tissue: Zhenshan97 flag leaf, score: 93.314 N N N N
vg0727546013 G -> C LOC_Os07g46140.1 downstream_gene_variant ; 3802.0bp to feature; MODIFIER N Average:88.291; most accessible tissue: Zhenshan97 flag leaf, score: 93.314 N N N N
vg0727546013 G -> T LOC_Os07g46160.1 synonymous_variant ; p.Gly157Gly; LOW synonymous_codon Average:88.291; most accessible tissue: Zhenshan97 flag leaf, score: 93.314 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727546013 G C 0.01 0.01 0.01 0.01 0.01 0.01
vg0727546013 G T -0.02 -0.02 -0.02 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727546013 NA 4.88E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 2.82E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 2.91E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 1.70E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 6.53E-06 NA mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 1.08E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 4.84E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 3.79E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 1.11E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 1.83E-09 mr1915 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 1.35E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 2.19E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 2.63E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727546013 NA 4.52E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251